Incidental Mutation 'R5729:Plxnd1'
ID452653
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission 043346-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5729 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115965877 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1282 (L1282P)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: L1282P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: L1282P

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Meta Mutation Damage Score 0.7171 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (62/64)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss A T 1: 177,796,258 V46E possibly damaging Het
Aldoart2 T C 12: 55,565,905 V205A probably benign Het
Atp1a2 A G 1: 172,293,371 S45P probably damaging Het
Atp4a A G 7: 30,712,426 K29E possibly damaging Het
AU040320 T A 4: 126,830,415 D428E probably damaging Het
Bend7 T C 2: 4,763,274 L347P probably damaging Het
Cacna2d1 T A 5: 15,935,039 L9* probably null Het
Ccdc103 A T 11: 102,883,078 I50F probably damaging Het
Cdc5l T C 17: 45,426,569 I88V probably benign Het
Cracr2a T C 6: 127,607,236 V86A possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dgkd C T 1: 87,936,332 Q90* probably null Het
Dnajc21 A T 15: 10,449,596 D446E probably benign Het
Fam13a T G 6: 58,939,307 R648S probably damaging Het
Gabrg2 A G 11: 41,967,623 V226A probably damaging Het
Gm5499 A T 17: 87,078,516 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Irf2bp1 G T 7: 19,005,247 E271* probably null Het
Krt86 T G 15: 101,476,548 V274G probably benign Het
Lats2 A T 14: 57,722,735 C151S probably benign Het
Mapk3 A T 7: 126,764,807 T254S probably benign Het
Mat2b A T 11: 40,682,546 M202K probably damaging Het
Mos A G 4: 3,870,971 Y282H probably benign Het
Myo3b A G 2: 70,105,739 K108R probably damaging Het
Naa16 A G 14: 79,355,780 Y417H probably damaging Het
Oat A T 7: 132,558,255 I412N probably damaging Het
Olfr1423 A T 19: 12,035,908 I278N probably damaging Het
Pcdh1 A T 18: 38,202,946 V73D probably damaging Het
Pigv A T 4: 133,664,823 Y345* probably null Het
Pitpnc1 G T 11: 107,337,438 F34L probably benign Het
Ppp1r3a T C 6: 14,719,763 D384G probably benign Het
Ppp2ca G A 11: 52,118,029 E119K probably damaging Het
Psg29 A T 7: 17,210,534 N323I probably damaging Het
Rasa4 T C 5: 136,093,162 V108A probably benign Het
Rbm14 A G 19: 4,802,549 probably benign Het
Rfc1 A T 5: 65,277,452 V657E probably damaging Het
Rhcg A T 7: 79,600,623 N237K probably damaging Het
Rpgrip1 A G 14: 52,160,160 Q1302R probably benign Het
Rragc A G 4: 123,924,852 M287V possibly damaging Het
Scn7a A G 2: 66,741,957 probably null Het
Sema6a C T 18: 47,281,343 C506Y probably damaging Het
Senp1 G T 15: 98,066,531 H267Q possibly damaging Het
Skor2 A G 18: 76,858,883 E100G unknown Het
Slc38a11 A T 2: 65,317,021 C371S probably benign Het
Snai3 G A 8: 122,454,890 A276V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spag6 C T 2: 18,715,714 T99I probably benign Het
Spop A G 11: 95,485,849 I243V possibly damaging Het
Sra1 A T 18: 36,667,443 probably benign Het
Stag3 T A 5: 138,290,223 S140T possibly damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d2b G C 9: 90,207,872 A868G probably benign Het
Tead2 A G 7: 45,220,742 probably benign Het
Tmem53 C A 4: 117,268,472 H261N probably damaging Het
Ube4a A T 9: 44,933,329 S932T probably damaging Het
Usp9y A T Y: 1,381,339 D827E probably damaging Het
Vmn2r53 T C 7: 12,600,806 E309G probably damaging Het
Wrn T C 8: 33,268,778 S1026G probably benign Het
Zfp646 G A 7: 127,885,454 A1760T probably damaging Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTAGTAGCTCCCAAATTCGTCTGC -3'
(R):5'- TTGTCTGTGAGGCTCAGAGC -3'

Sequencing Primer
(F):5'- ATTCGTCTGCCTCACATCCAAAG -3'
(R):5'- GCTCAGAGCACACAACAGTAAGAAG -3'
Posted On2017-01-03