Incidental Mutation 'R5729:Gprc5c'
ID 452674
Institutional Source Beutler Lab
Gene Symbol Gprc5c
Ensembl Gene ENSMUSG00000051043
Gene Name G protein-coupled receptor, family C, group 5, member C
Synonyms
MMRRC Submission 043346-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock # R5729 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 114851152-114872617 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 114864267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 257 (V257L)
Ref Sequence ENSEMBL: ENSMUSP00000061760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021071] [ENSMUST00000053361] [ENSMUST00000122967] [ENSMUST00000133245] [ENSMUST00000136785] [ENSMUST00000142262] [ENSMUST00000152314] [ENSMUST00000177952]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000021071
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021071
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000053361
AA Change: V257L

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061760
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 60 301 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122967
SMART Domains Protein: ENSMUSP00000114335
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133245
SMART Domains Protein: ENSMUSP00000121572
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
transmembrane domain 55 77 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000136785
AA Change: V257L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116786
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 283 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142262
SMART Domains Protein: ENSMUSP00000121524
Gene: ENSMUSG00000051043

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 133 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152314
Predicted Effect possibly damaging
Transcript: ENSMUST00000177952
AA Change: V257L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136702
Gene: ENSMUSG00000051043
AA Change: V257L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:7tm_3 58 302 1.3e-42 PFAM
Meta Mutation Damage Score 0.1280 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a reporter allele are behaviorally normal but exhibit reticulocytosis, increased mean corpuscular volume, increased percentage of basophils, decreased mean corpuscular hemogloblin concentration, and increased alkaline phophatase and lactic dehydrogenase levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss A T 1: 177,796,258 V46E possibly damaging Het
Aldoart2 T C 12: 55,565,905 V205A probably benign Het
Atp1a2 A G 1: 172,293,371 S45P probably damaging Het
Atp4a A G 7: 30,712,426 K29E possibly damaging Het
AU040320 T A 4: 126,830,415 D428E probably damaging Het
Bend7 T C 2: 4,763,274 L347P probably damaging Het
Cacna2d1 T A 5: 15,935,039 L9* probably null Het
Ccdc103 A T 11: 102,883,078 I50F probably damaging Het
Cdc5l T C 17: 45,426,569 I88V probably benign Het
Cracr2a T C 6: 127,607,236 V86A possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dgkd C T 1: 87,936,332 Q90* probably null Het
Dnajc21 A T 15: 10,449,596 D446E probably benign Het
Fam13a T G 6: 58,939,307 R648S probably damaging Het
Gabrg2 A G 11: 41,967,623 V226A probably damaging Het
Gm5499 A T 17: 87,078,516 noncoding transcript Het
Irf2bp1 G T 7: 19,005,247 E271* probably null Het
Krt86 T G 15: 101,476,548 V274G probably benign Het
Lats2 A T 14: 57,722,735 C151S probably benign Het
Mapk3 A T 7: 126,764,807 T254S probably benign Het
Mat2b A T 11: 40,682,546 M202K probably damaging Het
Mos A G 4: 3,870,971 Y282H probably benign Het
Myo3b A G 2: 70,105,739 K108R probably damaging Het
Naa16 A G 14: 79,355,780 Y417H probably damaging Het
Oat A T 7: 132,558,255 I412N probably damaging Het
Olfr1423 A T 19: 12,035,908 I278N probably damaging Het
Pcdh1 A T 18: 38,202,946 V73D probably damaging Het
Pigv A T 4: 133,664,823 Y345* probably null Het
Pitpnc1 G T 11: 107,337,438 F34L probably benign Het
Plxnd1 A G 6: 115,965,877 L1282P probably damaging Het
Ppp1r3a T C 6: 14,719,763 D384G probably benign Het
Ppp2ca G A 11: 52,118,029 E119K probably damaging Het
Psg29 A T 7: 17,210,534 N323I probably damaging Het
Rasa4 T C 5: 136,093,162 V108A probably benign Het
Rbm14 A G 19: 4,802,549 probably benign Het
Rfc1 A T 5: 65,277,452 V657E probably damaging Het
Rhcg A T 7: 79,600,623 N237K probably damaging Het
Rpgrip1 A G 14: 52,160,160 Q1302R probably benign Het
Rragc A G 4: 123,924,852 M287V possibly damaging Het
Scn7a A G 2: 66,741,957 probably null Het
Sema6a C T 18: 47,281,343 C506Y probably damaging Het
Senp1 G T 15: 98,066,531 H267Q possibly damaging Het
Skor2 A G 18: 76,858,883 E100G unknown Het
Slc38a11 A T 2: 65,317,021 C371S probably benign Het
Snai3 G A 8: 122,454,890 A276V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spag6 C T 2: 18,715,714 T99I probably benign Het
Spop A G 11: 95,485,849 I243V possibly damaging Het
Sra1 A T 18: 36,667,443 probably benign Het
Stag3 T A 5: 138,290,223 S140T possibly damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d2b G C 9: 90,207,872 A868G probably benign Het
Tead2 A G 7: 45,220,742 probably benign Het
Tmem53 C A 4: 117,268,472 H261N probably damaging Het
Ube4a A T 9: 44,933,329 S932T probably damaging Het
Usp9y A T Y: 1,381,339 D827E probably damaging Het
Vmn2r53 T C 7: 12,600,806 E309G probably damaging Het
Wrn T C 8: 33,268,778 S1026G probably benign Het
Zfp646 G A 7: 127,885,454 A1760T probably damaging Het
Other mutations in Gprc5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Gprc5c APN 11 114864252 missense probably benign 0.01
IGL01762:Gprc5c APN 11 114864024 missense probably benign 0.28
IGL02039:Gprc5c APN 11 114864486 nonsense probably null
R0800:Gprc5c UTSW 11 114866711 missense probably damaging 0.99
R1618:Gprc5c UTSW 11 114864394 missense possibly damaging 0.88
R4198:Gprc5c UTSW 11 114863860 missense probably damaging 1.00
R4807:Gprc5c UTSW 11 114864498 missense probably damaging 0.97
R4846:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4902:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R4904:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5016:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5048:Gprc5c UTSW 11 114870351 makesense probably null
R5106:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5109:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5173:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5266:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5267:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5475:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5508:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5557:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5562:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5563:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5598:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5599:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5756:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5792:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5793:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5794:Gprc5c UTSW 11 114864267 missense possibly damaging 0.92
R5817:Gprc5c UTSW 11 114863624 nonsense probably null
R5976:Gprc5c UTSW 11 114864487 missense possibly damaging 0.89
R6151:Gprc5c UTSW 11 114864025 missense probably damaging 1.00
R6617:Gprc5c UTSW 11 114864105 missense probably benign 0.05
R7108:Gprc5c UTSW 11 114864282 missense probably damaging 1.00
R7191:Gprc5c UTSW 11 114868617 missense possibly damaging 0.56
R7796:Gprc5c UTSW 11 114864532 missense probably damaging 0.97
R8543:Gprc5c UTSW 11 114864268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTCAGTGCCGACTCGAC -3'
(R):5'- TGCTCCTTCAGGATGGTCTCATAG -3'

Sequencing Primer
(F):5'- GACCATGACCTCTCCGTGTG -3'
(R):5'- TCAGGATGGTCTCATAGCCCAC -3'
Posted On 2017-01-03