Incidental Mutation 'R0553:Klhl41'
ID 45268
Institutional Source Beutler Lab
Gene Symbol Klhl41
Ensembl Gene ENSMUSG00000075307
Gene Name kelch-like 41
Synonyms LOC228003, Kbtbd10
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69670120-69684230 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69670210 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 5 (R5Q)
Ref Sequence ENSEMBL: ENSMUSP00000097627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074963] [ENSMUST00000100050] [ENSMUST00000112286] [ENSMUST00000134659]
AlphaFold A2AUC9
Predicted Effect probably benign
Transcript: ENSMUST00000074963
SMART Domains Protein: ENSMUSP00000074494
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 7 339 6.2e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100050
AA Change: R5Q

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097627
Gene: ENSMUSG00000075307
AA Change: R5Q

DomainStartEndE-ValueType
BTB 33 130 8.34e-27 SMART
BACK 135 237 9.67e-36 SMART
Kelch 346 398 6.71e-1 SMART
Kelch 399 447 1.56e-5 SMART
Kelch 448 495 2.43e-7 SMART
Kelch 496 542 5.81e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112286
SMART Domains Protein: ENSMUSP00000107905
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 208 1.6e-100 PFAM
Pfam:DUF1448 206 319 9.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127806
SMART Domains Protein: ENSMUSP00000121691
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 22 90 9.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134659
SMART Domains Protein: ENSMUSP00000119377
Gene: ENSMUSG00000063145

DomainStartEndE-ValueType
Pfam:DUF1448 6 88 3.1e-36 PFAM
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the kelch-like family. The encoded protein contains a BACK domain, a BTB/POZ domain, and 5 Kelch repeats. This protein is thought to function in skeletal muscle development and maintenance. Mutations in this gene have been associated with nemaline myopathy (NM), a rare congenital muscle disorder. [provided by RefSeq, Mar 2015]
PHENOTYPE: The gene product is involved in stabilizing proteins involved in muscle function. Homozygous knockout affects the structure of muscle fibers and their sarcomeres, resulting in neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Klhl41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Klhl41 APN 2 69674724 missense probably benign 0.00
IGL01622:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL01623:Klhl41 APN 2 69678238 missense probably benign 0.05
IGL03237:Klhl41 APN 2 69670558 missense possibly damaging 0.94
R0220:Klhl41 UTSW 2 69670485 missense probably benign 0.25
R0277:Klhl41 UTSW 2 69671296 missense probably damaging 1.00
R0456:Klhl41 UTSW 2 69670549 missense probably damaging 0.99
R0485:Klhl41 UTSW 2 69671256 missense probably damaging 0.97
R0536:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0537:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0552:Klhl41 UTSW 2 69670210 missense probably benign 0.04
R0834:Klhl41 UTSW 2 69678147 missense possibly damaging 0.76
R0879:Klhl41 UTSW 2 69683483 unclassified probably benign
R1531:Klhl41 UTSW 2 69670740 missense probably benign 0.03
R1678:Klhl41 UTSW 2 69670939 missense probably benign 0.01
R1792:Klhl41 UTSW 2 69670802 missense probably benign 0.01
R1900:Klhl41 UTSW 2 69674619 splice site probably benign
R2012:Klhl41 UTSW 2 69683496 missense possibly damaging 0.61
R4041:Klhl41 UTSW 2 69670710 missense probably benign 0.00
R5223:Klhl41 UTSW 2 69679827 nonsense probably null
R5500:Klhl41 UTSW 2 69683529 missense probably damaging 1.00
R5643:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5644:Klhl41 UTSW 2 69670471 missense probably damaging 1.00
R5656:Klhl41 UTSW 2 69683532 missense possibly damaging 0.89
R6264:Klhl41 UTSW 2 69679832 critical splice donor site probably null
R6678:Klhl41 UTSW 2 69670844 missense probably benign 0.04
R6731:Klhl41 UTSW 2 69674700 missense probably damaging 1.00
R7586:Klhl41 UTSW 2 69674724 missense probably benign 0.33
R7664:Klhl41 UTSW 2 69670717 missense probably damaging 1.00
R8158:Klhl41 UTSW 2 69671161 missense probably damaging 1.00
R8341:Klhl41 UTSW 2 69670524 missense probably benign 0.07
X0021:Klhl41 UTSW 2 69679706 missense probably damaging 1.00
Z1088:Klhl41 UTSW 2 69674730 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AGCTGAACAGCAGCACTCCTTTCC -3'
(R):5'- ATCCACGTTGTCTAGGGCTACCTC -3'

Sequencing Primer
(F):5'- CCTAAATTCCCGTTGTTAGAGC -3'
(R):5'- GTCTAGGGCTACCTCCTTTTTTTTC -3'
Posted On 2013-06-11