Incidental Mutation 'R0553:Ccdc173'
ID45269
Institutional Source Beutler Lab
Gene Symbol Ccdc173
Ensembl Gene ENSMUSG00000070883
Gene Namecoiled-coil domain containing 173
Synonyms4930525K21Rik, 4930578N16Rik
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R0553 (G1)
Quality Score139
Status Validated
Chromosome2
Chromosomal Location69758033-69789575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69789441 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 8 (R8L)
Ref Sequence ENSEMBL: ENSMUSP00000092548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028494] [ENSMUST00000094942] [ENSMUST00000112266] [ENSMUST00000151298] [ENSMUST00000180290]
Predicted Effect probably benign
Transcript: ENSMUST00000028494
SMART Domains Protein: ENSMUSP00000028494
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 1.2e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094942
AA Change: R8L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092548
Gene: ENSMUSG00000070883
AA Change: R8L

DomainStartEndE-ValueType
coiled coil region 47 131 N/A INTRINSIC
Pfam:TPH 142 475 8.9e-22 PFAM
low complexity region 494 508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112266
SMART Domains Protein: ENSMUSP00000107885
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 9.3e-99 PFAM
Pfam:HAD_2 5 128 8.9e-7 PFAM
Pfam:HAD 5 187 3.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131100
Predicted Effect probably benign
Transcript: ENSMUST00000151298
SMART Domains Protein: ENSMUSP00000118021
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 51 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180290
SMART Domains Protein: ENSMUSP00000136471
Gene: ENSMUSG00000027088

DomainStartEndE-ValueType
Pfam:Put_Phosphatase 3 239 9.3e-99 PFAM
Pfam:HAD_2 5 128 8.9e-7 PFAM
Pfam:HAD 5 187 3.2e-15 PFAM
Meta Mutation Damage Score 0.2586 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Ccdc173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Ccdc173 APN 2 69771984 missense probably benign
IGL01768:Ccdc173 APN 2 69782127 splice site probably benign
IGL01801:Ccdc173 APN 2 69776279 splice site probably benign
R1226:Ccdc173 UTSW 2 69787209 missense possibly damaging 0.63
R1867:Ccdc173 UTSW 2 69781837 splice site probably null
R4821:Ccdc173 UTSW 2 69782108 missense possibly damaging 0.76
R5309:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5312:Ccdc173 UTSW 2 69787258 missense possibly damaging 0.92
R5916:Ccdc173 UTSW 2 69789462 start codon destroyed probably null 0.95
R6072:Ccdc173 UTSW 2 69772058 missense probably benign 0.31
R6232:Ccdc173 UTSW 2 69772054 missense possibly damaging 0.64
R6236:Ccdc173 UTSW 2 69758041 utr 3 prime probably null
R6909:Ccdc173 UTSW 2 69781848 intron probably null
R7497:Ccdc173 UTSW 2 69758448 missense probably benign 0.04
R7502:Ccdc173 UTSW 2 69776144 missense probably benign
R7786:Ccdc173 UTSW 2 69781748 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACCTGCCTAACTTCCAAGGATG -3'
(R):5'- TTCCAAACTAGCGCAGCGAGTG -3'

Sequencing Primer
(F):5'- AACTTCCAAGGATGCTTGCTG -3'
(R):5'- TTACGCAGCCGGTGAAC -3'
Posted On2013-06-11