Incidental Mutation 'R5729:Rbm14'
ID452690
Institutional Source Beutler Lab
Gene Symbol Rbm14
Ensembl Gene ENSMUSG00000006456
Gene NameRNA binding motif protein 14
SynonymsPSP2, 1300007E16Rik, p16
MMRRC Submission 043346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5729 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location4800569-4811634 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 4802549 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006625] [ENSMUST00000113793] [ENSMUST00000172000] [ENSMUST00000178353] [ENSMUST00000179909] [ENSMUST00000180008]
Predicted Effect probably benign
Transcript: ENSMUST00000006625
SMART Domains Protein: ENSMUSP00000006625
Gene: ENSMUSG00000006456

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 145 2.52e-20 SMART
low complexity region 212 225 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
low complexity region 368 458 N/A INTRINSIC
low complexity region 483 511 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000113793
AA Change: Y602H
SMART Domains Protein: ENSMUSP00000109424
Gene: ENSMUSG00000006456
AA Change: Y602H

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 145 2.52e-20 SMART
low complexity region 212 225 N/A INTRINSIC
low complexity region 287 304 N/A INTRINSIC
low complexity region 346 357 N/A INTRINSIC
low complexity region 368 458 N/A INTRINSIC
low complexity region 483 511 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172000
SMART Domains Protein: ENSMUSP00000128810
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 116 1.5e-5 PFAM
RRM 119 184 5.4e-20 SMART
RRM 195 260 4.77e-21 SMART
ZnF_C2HC 277 293 1.75e-5 SMART
low complexity region 343 362 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177776
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178727
Predicted Effect probably benign
Transcript: ENSMUST00000179909
SMART Domains Protein: ENSMUSP00000136623
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 138 1.83e0 SMART
ZnF_C2HC 136 152 1.75e-5 SMART
low complexity region 202 221 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180008
SMART Domains Protein: ENSMUSP00000137466
Gene: ENSMUSG00000006456

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 6e-7 PFAM
Meta Mutation Damage Score 0.0918 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonucleoprotein that functions as a general nuclear coactivator, and an RNA splicing modulator. This protein contains two RNA recognition motifs (RRM) at the N-terminus, and multiple hexapeptide repeat domain at the C-terminus that interacts with thyroid hormone receptor-binding protein (TRBP), and is required for transcription activation. Alternatively spliced transcript variants encoding different isoforms (with opposing effects on transcription) have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss A T 1: 177,796,258 V46E possibly damaging Het
Aldoart2 T C 12: 55,565,905 V205A probably benign Het
Atp1a2 A G 1: 172,293,371 S45P probably damaging Het
Atp4a A G 7: 30,712,426 K29E possibly damaging Het
AU040320 T A 4: 126,830,415 D428E probably damaging Het
Bend7 T C 2: 4,763,274 L347P probably damaging Het
Cacna2d1 T A 5: 15,935,039 L9* probably null Het
Ccdc103 A T 11: 102,883,078 I50F probably damaging Het
Cdc5l T C 17: 45,426,569 I88V probably benign Het
Cracr2a T C 6: 127,607,236 V86A possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dgkd C T 1: 87,936,332 Q90* probably null Het
Dnajc21 A T 15: 10,449,596 D446E probably benign Het
Fam13a T G 6: 58,939,307 R648S probably damaging Het
Gabrg2 A G 11: 41,967,623 V226A probably damaging Het
Gm5499 A T 17: 87,078,516 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Irf2bp1 G T 7: 19,005,247 E271* probably null Het
Krt86 T G 15: 101,476,548 V274G probably benign Het
Lats2 A T 14: 57,722,735 C151S probably benign Het
Mapk3 A T 7: 126,764,807 T254S probably benign Het
Mat2b A T 11: 40,682,546 M202K probably damaging Het
Mos A G 4: 3,870,971 Y282H probably benign Het
Myo3b A G 2: 70,105,739 K108R probably damaging Het
Naa16 A G 14: 79,355,780 Y417H probably damaging Het
Oat A T 7: 132,558,255 I412N probably damaging Het
Olfr1423 A T 19: 12,035,908 I278N probably damaging Het
Pcdh1 A T 18: 38,202,946 V73D probably damaging Het
Pigv A T 4: 133,664,823 Y345* probably null Het
Pitpnc1 G T 11: 107,337,438 F34L probably benign Het
Plxnd1 A G 6: 115,965,877 L1282P probably damaging Het
Ppp1r3a T C 6: 14,719,763 D384G probably benign Het
Ppp2ca G A 11: 52,118,029 E119K probably damaging Het
Psg29 A T 7: 17,210,534 N323I probably damaging Het
Rasa4 T C 5: 136,093,162 V108A probably benign Het
Rfc1 A T 5: 65,277,452 V657E probably damaging Het
Rhcg A T 7: 79,600,623 N237K probably damaging Het
Rpgrip1 A G 14: 52,160,160 Q1302R probably benign Het
Rragc A G 4: 123,924,852 M287V possibly damaging Het
Scn7a A G 2: 66,741,957 probably null Het
Sema6a C T 18: 47,281,343 C506Y probably damaging Het
Senp1 G T 15: 98,066,531 H267Q possibly damaging Het
Skor2 A G 18: 76,858,883 E100G unknown Het
Slc38a11 A T 2: 65,317,021 C371S probably benign Het
Snai3 G A 8: 122,454,890 A276V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spag6 C T 2: 18,715,714 T99I probably benign Het
Spop A G 11: 95,485,849 I243V possibly damaging Het
Sra1 A T 18: 36,667,443 probably benign Het
Stag3 T A 5: 138,290,223 S140T possibly damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d2b G C 9: 90,207,872 A868G probably benign Het
Tead2 A G 7: 45,220,742 probably benign Het
Tmem53 C A 4: 117,268,472 H261N probably damaging Het
Ube4a A T 9: 44,933,329 S932T probably damaging Het
Usp9y A T Y: 1,381,339 D827E probably damaging Het
Vmn2r53 T C 7: 12,600,806 E309G probably damaging Het
Wrn T C 8: 33,268,778 S1026G probably benign Het
Zfp646 G A 7: 127,885,454 A1760T probably damaging Het
Other mutations in Rbm14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Rbm14 APN 19 4802548 intron probably benign
IGL00430:Rbm14 APN 19 4811426 missense probably damaging 1.00
IGL02226:Rbm14 APN 19 4801717 unclassified probably benign
R1732:Rbm14 UTSW 19 4803467 missense probably benign 0.03
R1840:Rbm14 UTSW 19 4801795 intron probably benign
R2044:Rbm14 UTSW 19 4803877 missense possibly damaging 0.90
R2362:Rbm14 UTSW 19 4801707 unclassified probably benign
R4656:Rbm14 UTSW 19 4811435 missense probably damaging 1.00
R4771:Rbm14 UTSW 19 4802643 intron probably benign
R5081:Rbm14 UTSW 19 4802795 missense probably benign 0.23
R6432:Rbm14 UTSW 19 4803163 intron probably benign
R6905:Rbm14 UTSW 19 4803236 intron probably benign
Predicted Primers PCR Primer
(F):5'- TTTGTTGGTATCACCCCAGGC -3'
(R):5'- ATTGGCTGCTTCCTATGCTG -3'

Sequencing Primer
(F):5'- ACCCCAGGCTGAGCACTATG -3'
(R):5'- TGCTGCCTCCTACCGTGG -3'
Posted On2017-01-03