Incidental Mutation 'R5730:Trak2'
ID452696
Institutional Source Beutler Lab
Gene Symbol Trak2
Ensembl Gene ENSMUSG00000026028
Gene Nametrafficking protein, kinesin binding 2
SynonymsGRIF-1, 4733401O11Rik, GRIF1, OIP98, CALS-C, 2900022D04Rik, Als2cr3
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58900449-58973430 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58921807 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 188 (D188G)
Ref Sequence ENSEMBL: ENSMUSP00000027186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027186] [ENSMUST00000173590] [ENSMUST00000174120]
Predicted Effect probably damaging
Transcript: ENSMUST00000027186
AA Change: D188G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027186
Gene: ENSMUSG00000026028
AA Change: D188G

DomainStartEndE-ValueType
Pfam:HAP1_N 48 353 2.5e-135 PFAM
Pfam:Milton 426 565 3e-26 PFAM
low complexity region 663 673 N/A INTRINSIC
low complexity region 693 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173590
SMART Domains Protein: ENSMUSP00000134499
Gene: ENSMUSG00000026028

DomainStartEndE-ValueType
Pfam:HAP1_N 2 52 9.4e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174120
AA Change: D188G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134253
Gene: ENSMUSG00000026028
AA Change: D188G

DomainStartEndE-ValueType
Pfam:HAP1_N 47 354 1.3e-129 PFAM
Pfam:Milton 411 565 1.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174359
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Trak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Trak2 APN 1 58923607 missense probably damaging 1.00
IGL01982:Trak2 APN 1 58926655 missense possibly damaging 0.94
IGL02154:Trak2 APN 1 58908729 missense probably damaging 1.00
IGL02399:Trak2 APN 1 58910045 missense probably benign 0.00
IGL02732:Trak2 APN 1 58910063 missense probably benign 0.19
IGL02734:Trak2 APN 1 58910063 missense probably benign 0.19
IGL03147:Trak2 UTSW 1 58910063 missense probably benign 0.19
P0041:Trak2 UTSW 1 58909964 missense probably damaging 1.00
R0079:Trak2 UTSW 1 58926724 missense probably damaging 1.00
R0791:Trak2 UTSW 1 58903661 missense probably benign
R0792:Trak2 UTSW 1 58903661 missense probably benign
R1099:Trak2 UTSW 1 58921841 missense probably benign 0.05
R1899:Trak2 UTSW 1 58946336 start codon destroyed probably null 0.98
R1903:Trak2 UTSW 1 58918855 splice site probably null
R2292:Trak2 UTSW 1 58935757 missense probably damaging 0.99
R2312:Trak2 UTSW 1 58935782 missense probably damaging 1.00
R3720:Trak2 UTSW 1 58946245 critical splice donor site probably null
R4966:Trak2 UTSW 1 58919321 missense probably damaging 1.00
R5088:Trak2 UTSW 1 58935808 missense probably benign 0.06
R5840:Trak2 UTSW 1 58919273 missense probably damaging 1.00
R5981:Trak2 UTSW 1 58908690 missense probably benign 0.01
R6000:Trak2 UTSW 1 58911812 missense possibly damaging 0.71
R6053:Trak2 UTSW 1 58904069 missense possibly damaging 0.62
R6894:Trak2 UTSW 1 58911733 missense probably damaging 1.00
R6916:Trak2 UTSW 1 58910025 missense probably benign 0.06
R7096:Trak2 UTSW 1 58903590 missense probably damaging 1.00
R7544:Trak2 UTSW 1 58921068 splice site probably null
R7847:Trak2 UTSW 1 58935818 missense possibly damaging 0.88
R7889:Trak2 UTSW 1 58918824 missense probably damaging 1.00
R7930:Trak2 UTSW 1 58935818 missense possibly damaging 0.88
R7972:Trak2 UTSW 1 58918824 missense probably damaging 1.00
R8039:Trak2 UTSW 1 58946288 missense probably benign 0.16
X0067:Trak2 UTSW 1 58908532 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TCTCCTACGCACTCAGCAAG -3'
(R):5'- TAGCATCTGATGGAAAACCAACTG -3'

Sequencing Primer
(F):5'- GATGCTATGCTGGGTCTCACC -3'
(R):5'- CCAACTGTTCCGTGAATTAGGAGC -3'
Posted On2017-01-03