Incidental Mutation 'R5730:Gpbar1'
ID452697
Institutional Source Beutler Lab
Gene Symbol Gpbar1
Ensembl Gene ENSMUSG00000064272
Gene NameG protein-coupled bile acid receptor 1
SynonymsBG37, GPR131, TGR5, M-BAR
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location74278550-74279624 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74279036 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 146 (N146S)
Ref Sequence ENSEMBL: ENSMUSP00000077135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006462] [ENSMUST00000077985] [ENSMUST00000178235] [ENSMUST00000187046] [ENSMUST00000190008]
Predicted Effect probably benign
Transcript: ENSMUST00000006462
SMART Domains Protein: ENSMUSP00000006462
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 34 42 N/A INTRINSIC
low complexity region 46 64 N/A INTRINSIC
WD40 81 121 2.76e-2 SMART
WD40 124 163 4.83e-7 SMART
WD40 166 203 7.96e0 SMART
WD40 205 244 2.51e-5 SMART
WD40 247 289 2.38e-6 SMART
WD40 292 346 2.47e1 SMART
WD40 349 387 2.61e-3 SMART
WD40 390 429 1.75e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077985
AA Change: N146S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077135
Gene: ENSMUSG00000064272
AA Change: N146S

DomainStartEndE-ValueType
Pfam:7tm_1 30 264 7.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178235
SMART Domains Protein: ENSMUSP00000136644
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
low complexity region 47 65 N/A INTRINSIC
WD40 82 122 2.76e-2 SMART
WD40 125 164 4.83e-7 SMART
WD40 167 204 7.96e0 SMART
WD40 206 245 2.51e-5 SMART
WD40 248 290 2.38e-6 SMART
WD40 293 347 2.47e1 SMART
WD40 350 388 2.61e-3 SMART
WD40 391 430 1.75e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186833
Predicted Effect probably benign
Transcript: ENSMUST00000187046
SMART Domains Protein: ENSMUSP00000139411
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
WD40 20 60 1.7e-4 SMART
WD40 63 102 3e-9 SMART
WD40 120 160 1.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187908
Predicted Effect probably benign
Transcript: ENSMUST00000190008
SMART Domains Protein: ENSMUSP00000140427
Gene: ENSMUSG00000006299

DomainStartEndE-ValueType
low complexity region 17 34 N/A INTRINSIC
low complexity region 40 58 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191258
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor (GPCR) superfamily. This enzyme functions as a cell surface receptor for bile acids. Treatment of cells expressing this GPCR with bile acids induces the production of intracellular cAMP, activation of a MAP kinase signaling pathway, and internalization of the receptor. The receptor is implicated in the suppression of macrophage functions and regulation of energy homeostasis by bile acids. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in abnormal cholesterol, bile, and insulin homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Gpbar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Gpbar1 UTSW 1 74278981 missense probably benign
R0502:Gpbar1 UTSW 1 74279392 missense probably benign 0.00
R0944:Gpbar1 UTSW 1 74279522 missense probably benign
R1993:Gpbar1 UTSW 1 74279444 missense possibly damaging 0.92
R1995:Gpbar1 UTSW 1 74279444 missense possibly damaging 0.92
R2216:Gpbar1 UTSW 1 74278894 missense probably damaging 1.00
R2258:Gpbar1 UTSW 1 74279005 missense probably benign
R4871:Gpbar1 UTSW 1 74279543 missense probably damaging 0.96
R4973:Gpbar1 UTSW 1 74279545 unclassified probably benign
R4974:Gpbar1 UTSW 1 74279545 unclassified probably benign
R4975:Gpbar1 UTSW 1 74279545 unclassified probably benign
R4979:Gpbar1 UTSW 1 74279245 missense probably benign 0.01
R5728:Gpbar1 UTSW 1 74279057 missense probably damaging 1.00
R7180:Gpbar1 UTSW 1 74278633 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TCCTAAGCCTACTACTAGCCGG -3'
(R):5'- TAGCCAGGGTTGAGGGTACATC -3'

Sequencing Primer
(F):5'- CTATGGAGCCGGAACCATCAG -3'
(R):5'- TACATCGCGGCACACTG -3'
Posted On2017-01-03