Incidental Mutation 'R5730:Scn3a'
ID452700
Institutional Source Beutler Lab
Gene Symbol Scn3a
Ensembl Gene ENSMUSG00000057182
Gene Namesodium channel, voltage-gated, type III, alpha
SynonymsNav1.3, LOC381367
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location65457118-65567627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65495260 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 971 (N971T)
Ref Sequence ENSEMBL: ENSMUSP00000097647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066432] [ENSMUST00000100069]
Predicted Effect probably benign
Transcript: ENSMUST00000066432
AA Change: N971T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065023
Gene: ENSMUSG00000057182
AA Change: N971T

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100069
AA Change: N971T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097647
Gene: ENSMUSG00000057182
AA Change: N971T

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:Ion_trans 127 435 5.2e-83 PFAM
low complexity region 473 498 N/A INTRINSIC
Pfam:Na_trans_cytopl 504 626 2e-42 PFAM
Pfam:Ion_trans 710 945 1.4e-58 PFAM
Pfam:Na_trans_assoc 949 1153 2.7e-58 PFAM
Pfam:Ion_trans 1157 1430 3e-67 PFAM
Pfam:Ion_trans 1477 1734 6.3e-55 PFAM
Pfam:PKD_channel 1573 1728 8e-7 PFAM
IQ 1851 1873 5.75e-2 SMART
low complexity region 1913 1921 N/A INTRINSIC
low complexity region 1927 1943 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155838
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is found in a cluster of five alpha subunit genes on chromosome 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in lethality of most mutants by weaning. Heterozygous mice exhibit improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Scn3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Scn3a APN 2 65497392 missense probably benign 0.05
IGL01086:Scn3a APN 2 65470159 missense probably benign 0.27
IGL01141:Scn3a APN 2 65495113 missense possibly damaging 0.73
IGL01150:Scn3a APN 2 65497365 splice site probably null
IGL01564:Scn3a APN 2 65461446 missense probably damaging 1.00
IGL01594:Scn3a APN 2 65461431 missense probably damaging 1.00
IGL01751:Scn3a APN 2 65461252 missense possibly damaging 0.87
IGL01803:Scn3a APN 2 65521783 unclassified probably benign
IGL01822:Scn3a APN 2 65495264 missense probably damaging 1.00
IGL02063:Scn3a APN 2 65461510 missense probably damaging 1.00
IGL02142:Scn3a APN 2 65526621 missense possibly damaging 0.95
IGL02198:Scn3a APN 2 65508489 missense probably benign 0.12
IGL02501:Scn3a APN 2 65526555 missense possibly damaging 0.82
IGL02608:Scn3a APN 2 65524166 nonsense probably null
IGL02645:Scn3a APN 2 65514527 missense probably benign 0.12
IGL02653:Scn3a APN 2 65461187 missense probably damaging 1.00
IGL03077:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03099:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03299:Scn3a APN 2 65497516 missense probably benign 0.01
IGL03327:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03346:Scn3a APN 2 65536672 missense probably damaging 0.99
IGL03355:Scn3a APN 2 65460568 missense possibly damaging 0.91
curtsey UTSW 2 65464836 missense probably damaging 1.00
dip UTSW 2 65524179 missense probably benign 0.01
Regime UTSW 2 65524850 missense possibly damaging 0.93
Willpower UTSW 2 65525754 missense possibly damaging 0.92
R0019:Scn3a UTSW 2 65461701 missense probably damaging 1.00
R0316:Scn3a UTSW 2 65460829 missense probably damaging 1.00
R0374:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R0414:Scn3a UTSW 2 65525982 splice site probably benign
R0609:Scn3a UTSW 2 65536510 missense probably damaging 0.96
R0613:Scn3a UTSW 2 65472284 missense possibly damaging 0.92
R0645:Scn3a UTSW 2 65524850 missense possibly damaging 0.93
R0665:Scn3a UTSW 2 65484411 missense probably null 0.00
R0667:Scn3a UTSW 2 65484411 missense probably null 0.00
R0710:Scn3a UTSW 2 65469046 missense probably damaging 0.99
R1202:Scn3a UTSW 2 65506147 missense probably benign 0.07
R1440:Scn3a UTSW 2 65529441 missense possibly damaging 0.95
R1447:Scn3a UTSW 2 65469980 missense probably damaging 1.00
R1564:Scn3a UTSW 2 65514635 missense probably damaging 0.98
R1595:Scn3a UTSW 2 65498979 missense probably damaging 0.99
R1775:Scn3a UTSW 2 65472342 missense probably damaging 1.00
R1781:Scn3a UTSW 2 65472385 missense probably damaging 1.00
R1822:Scn3a UTSW 2 65484372 missense probably damaging 1.00
R1924:Scn3a UTSW 2 65461534 missense probably damaging 1.00
R2061:Scn3a UTSW 2 65461308 missense probably damaging 1.00
R2070:Scn3a UTSW 2 65520866 missense possibly damaging 0.72
R2174:Scn3a UTSW 2 65507206 missense probably damaging 0.99
R2656:Scn3a UTSW 2 65526518 missense probably damaging 0.99
R2680:Scn3a UTSW 2 65536536 missense probably benign 0.04
R3882:Scn3a UTSW 2 65482279 missense probably benign 0.03
R4019:Scn3a UTSW 2 65525951 intron probably benign
R4106:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4108:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4109:Scn3a UTSW 2 65495035 missense probably benign 0.07
R4225:Scn3a UTSW 2 65536427 missense probably damaging 0.99
R4419:Scn3a UTSW 2 65466960 missense probably damaging 1.00
R4552:Scn3a UTSW 2 65524179 missense probably benign 0.01
R4687:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R4780:Scn3a UTSW 2 65506193 missense probably damaging 1.00
R4820:Scn3a UTSW 2 65461278 missense probably damaging 1.00
R4856:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4886:Scn3a UTSW 2 65461032 missense probably damaging 1.00
R4914:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4915:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R4918:Scn3a UTSW 2 65461455 missense probably damaging 1.00
R5088:Scn3a UTSW 2 65472299 missense probably damaging 1.00
R5101:Scn3a UTSW 2 65461506 missense probably damaging 1.00
R5128:Scn3a UTSW 2 65508518 missense probably benign 0.08
R5132:Scn3a UTSW 2 65468204 missense probably benign 0.09
R5297:Scn3a UTSW 2 65469034 missense possibly damaging 0.83
R5595:Scn3a UTSW 2 65460713 missense probably benign
R5699:Scn3a UTSW 2 65507264 missense possibly damaging 0.54
R5735:Scn3a UTSW 2 65482278 missense probably damaging 0.98
R5735:Scn3a UTSW 2 65484459 missense probably benign 0.09
R5855:Scn3a UTSW 2 65464730 missense possibly damaging 0.65
R5888:Scn3a UTSW 2 65497398 missense probably benign 0.06
R5898:Scn3a UTSW 2 65514695 missense probably damaging 0.96
R5935:Scn3a UTSW 2 65464836 missense probably damaging 1.00
R5970:Scn3a UTSW 2 65494781 intron probably benign
R6214:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6215:Scn3a UTSW 2 65495036 missense probably benign 0.29
R6235:Scn3a UTSW 2 65461335 missense probably damaging 0.97
R6307:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R6355:Scn3a UTSW 2 65461299 missense probably damaging 0.99
R6376:Scn3a UTSW 2 65461499 missense possibly damaging 0.88
R6517:Scn3a UTSW 2 65497563 missense possibly damaging 0.73
R6775:Scn3a UTSW 2 65521815 missense possibly damaging 0.82
R6893:Scn3a UTSW 2 65525754 missense possibly damaging 0.92
R6986:Scn3a UTSW 2 65508618 missense probably damaging 0.97
R7065:Scn3a UTSW 2 65464855 missense probably benign
R7078:Scn3a UTSW 2 65497600 missense probably damaging 1.00
R7146:Scn3a UTSW 2 65483142 missense probably damaging 1.00
R7240:Scn3a UTSW 2 65469042 missense possibly damaging 0.77
R7294:Scn3a UTSW 2 65472341 missense probably damaging 1.00
R7352:Scn3a UTSW 2 65525701 missense possibly damaging 0.51
R7636:Scn3a UTSW 2 65497689 missense probably damaging 1.00
R7708:Scn3a UTSW 2 65483168 missense possibly damaging 0.47
R7733:Scn3a UTSW 2 65508650 missense probably benign 0.08
R7761:Scn3a UTSW 2 65529454 missense possibly damaging 0.95
R7792:Scn3a UTSW 2 65466990 nonsense probably null
R7828:Scn3a UTSW 2 65508574 missense probably damaging 0.97
R7875:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7884:Scn3a UTSW 2 65536515 missense probably damaging 0.96
R7958:Scn3a UTSW 2 65497482 missense probably damaging 1.00
R7967:Scn3a UTSW 2 65536515 missense probably damaging 0.96
X0062:Scn3a UTSW 2 65467001 missense probably damaging 0.98
X0062:Scn3a UTSW 2 65524847 nonsense probably null
Z1177:Scn3a UTSW 2 65498892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTCTCCCACGGCAATTG -3'
(R):5'- CCCGAGTGTCAGTTTTAACAC -3'

Sequencing Primer
(F):5'- GCAATTGGCACCGTCACG -3'
(R):5'- GTGTCAGTTTTAACACGGTCC -3'
Posted On2017-01-03