Incidental Mutation 'R5730:Tubb1'
ID452704
Institutional Source Beutler Lab
Gene Symbol Tubb1
Ensembl Gene ENSMUSG00000016255
Gene Nametubulin, beta 1 class VI
Synonyms
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location174450695-174457882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 174457769 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 415 (I415V)
Ref Sequence ENSEMBL: ENSMUSP00000016399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016396] [ENSMUST00000016399]
Predicted Effect probably benign
Transcript: ENSMUST00000016396
SMART Domains Protein: ENSMUSP00000016396
Gene: ENSMUSG00000016252

DomainStartEndE-ValueType
Pfam:ATP-synt_Eps 2 51 7.8e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000016399
AA Change: I415V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000016399
Gene: ENSMUSG00000016255
AA Change: I415V

DomainStartEndE-ValueType
Tubulin 47 244 3.42e-68 SMART
Tubulin_C 246 383 1.84e-41 SMART
low complexity region 433 448 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153132
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta tubulin protein family. Beta tubulins are one of two core protein families (alpha and beta tubulins) that heterodimerize and assemble to form microtubules. This protein is specifically expressed in platelets and megakaryocytes and may be involved in proplatelet production and platelet release. A mutations in this gene is associated with autosomal dominant macrothrombocytopenia. Two pseudogenes of this gene are found on chromosome Y.[provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygotes have thrombocytopenia resulting from a defect in generating proplatelets. The platelets that are produced have structural and functional defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Tubb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01877:Tubb1 APN 2 174456898 missense possibly damaging 0.87
IGL02534:Tubb1 APN 2 174455669 missense probably benign 0.04
IGL02535:Tubb1 APN 2 174457566 missense probably benign 0.00
IGL03404:Tubb1 APN 2 174457448 missense probably damaging 1.00
R0117:Tubb1 UTSW 2 174457784 missense probably benign 0.00
R0666:Tubb1 UTSW 2 174457755 missense probably damaging 0.98
R0939:Tubb1 UTSW 2 174455756 missense probably damaging 1.00
R1163:Tubb1 UTSW 2 174457739 missense probably benign
R1317:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1458:Tubb1 UTSW 2 174450803 critical splice donor site probably null
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1574:Tubb1 UTSW 2 174457422 missense probably benign
R1658:Tubb1 UTSW 2 174456623 missense probably damaging 1.00
R1751:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1761:Tubb1 UTSW 2 174456896 missense probably benign 0.16
R1869:Tubb1 UTSW 2 174456689 missense probably benign 0.00
R1969:Tubb1 UTSW 2 174455691 missense possibly damaging 0.92
R2412:Tubb1 UTSW 2 174457110 missense possibly damaging 0.71
R4249:Tubb1 UTSW 2 174455733 missense probably null 0.93
R4415:Tubb1 UTSW 2 174457673 missense probably benign 0.12
R5154:Tubb1 UTSW 2 174456864 missense probably benign 0.19
R5276:Tubb1 UTSW 2 174457424 missense probably damaging 0.97
R6008:Tubb1 UTSW 2 174457774 missense probably benign 0.00
R6719:Tubb1 UTSW 2 174457394 missense probably damaging 1.00
R7422:Tubb1 UTSW 2 174457032 missense possibly damaging 0.76
X0063:Tubb1 UTSW 2 174457295 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAATGTCAAGGTAGCTGTGTG -3'
(R):5'- TAGGGCTCACTACAGTAAACTCAC -3'

Sequencing Primer
(F):5'- CAAGGTAGCTGTGTGTGACATCC -3'
(R):5'- GGCTGCCCTATAGCTTCT -3'
Posted On2017-01-03