Incidental Mutation 'R5730:Synpo2'
ID 452706
Institutional Source Beutler Lab
Gene Symbol Synpo2
Ensembl Gene ENSMUSG00000050315
Gene Name synaptopodin 2
Synonyms 1110069I04Rik, 2310068J10Rik, 9530006G20Rik, myopodin, Myo
MMRRC Submission 043191-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5730 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 122870168-123029798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122907768 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 516 (D516G)
Ref Sequence ENSEMBL: ENSMUSP00000102035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051443] [ENSMUST00000106426] [ENSMUST00000106427] [ENSMUST00000184590] [ENSMUST00000198584]
AlphaFold Q91YE8
Predicted Effect probably benign
Transcript: ENSMUST00000051443
AA Change: D186G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000051570
Gene: ENSMUSG00000050315
AA Change: D186G

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106426
AA Change: D516G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102034
Gene: ENSMUSG00000050315
AA Change: D516G

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 4.61e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 2.92e-7 PROSPERO
internal_repeat_2 478 499 4.61e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 2.92e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
low complexity region 1196 1211 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106427
AA Change: D516G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102035
Gene: ENSMUSG00000050315
AA Change: D516G

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 6.19e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 4.33e-7 PROSPERO
internal_repeat_2 478 499 6.19e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 4.33e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1137 1152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139160
SMART Domains Protein: ENSMUSP00000123396
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184590
SMART Domains Protein: ENSMUSP00000142426
Gene: ENSMUSG00000050315

DomainStartEndE-ValueType
low complexity region 48 57 N/A INTRINSIC
low complexity region 141 158 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198584
AA Change: D516G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142508
Gene: ENSMUSG00000050315
AA Change: D516G

DomainStartEndE-ValueType
PDZ 15 88 6.51e-14 SMART
low complexity region 339 357 N/A INTRINSIC
internal_repeat_2 377 398 1.92e-5 PROSPERO
low complexity region 406 424 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
internal_repeat_1 477 503 1.04e-7 PROSPERO
internal_repeat_2 478 499 1.92e-5 PROSPERO
low complexity region 534 549 N/A INTRINSIC
low complexity region 609 621 N/A INTRINSIC
low complexity region 628 651 N/A INTRINSIC
low complexity region 740 777 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
low complexity region 846 854 N/A INTRINSIC
internal_repeat_1 858 884 1.04e-7 PROSPERO
low complexity region 941 950 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,987,617 (GRCm39) V2967A possibly damaging Het
Apaf1 A T 10: 90,856,633 (GRCm39) I858K possibly damaging Het
Baiap3 T C 17: 25,466,498 (GRCm39) T466A probably benign Het
Brca2 T A 5: 150,492,470 (GRCm39) S3162T possibly damaging Het
Brd1 T G 15: 88,601,248 (GRCm39) N462T probably benign Het
Carm1 G A 9: 21,491,636 (GRCm39) R235H probably benign Het
Cd80 T C 16: 38,303,097 (GRCm39) probably null Het
Clip4 A G 17: 72,117,954 (GRCm39) Y333C probably damaging Het
Col7a1 T C 9: 108,801,310 (GRCm39) probably null Het
Csmd1 G A 8: 16,235,206 (GRCm39) Q1206* probably null Het
Cyp17a1 A G 19: 46,661,095 (GRCm39) I63T possibly damaging Het
Diaph1 A G 18: 38,036,829 (GRCm39) Y119H unknown Het
Dst T G 1: 34,156,607 (GRCm39) probably null Het
Fgfr1 A G 8: 26,063,827 (GRCm39) T785A probably damaging Het
Gm1553 A G 10: 82,323,945 (GRCm39) F94S unknown Het
Gpbar1 A G 1: 74,318,195 (GRCm39) N146S probably damaging Het
Gpc5 A G 14: 116,025,726 (GRCm39) T588A possibly damaging Het
Gramd2a A G 9: 59,618,489 (GRCm39) H9R probably damaging Het
Klk1b11 G A 7: 43,424,199 (GRCm39) S6N probably benign Het
Lrp1 A G 10: 127,419,703 (GRCm39) S969P probably benign Het
Lyz2 G T 10: 117,114,587 (GRCm39) A114E probably damaging Het
Madd T C 2: 90,988,454 (GRCm39) D1193G probably damaging Het
Mrpl39 C T 16: 84,529,322 (GRCm39) G107R probably damaging Het
Mthfd2 C T 6: 83,294,441 (GRCm39) R24H probably benign Het
Or2q1 C T 6: 42,795,094 (GRCm39) R230* probably null Het
Or4a68 T C 2: 89,269,780 (GRCm39) N281S probably damaging Het
Ovch2 A G 7: 107,392,606 (GRCm39) C246R probably damaging Het
Phf14 A T 6: 11,953,319 (GRCm39) I353F possibly damaging Het
Ppp2r5a C T 1: 191,104,732 (GRCm39) V105I probably benign Het
Prr14l T C 5: 32,950,947 (GRCm39) T1949A probably damaging Het
Prss48 T G 3: 85,904,563 (GRCm39) M212L possibly damaging Het
Pstk A T 7: 130,975,503 (GRCm39) D152V probably damaging Het
Scn2a C A 2: 65,512,882 (GRCm39) S214* probably null Het
Scn3a T G 2: 65,325,604 (GRCm39) N971T probably benign Het
Syne3 T C 12: 104,927,713 (GRCm39) I250V probably benign Het
Tcea3 T C 4: 135,992,204 (GRCm39) V209A probably benign Het
Tnr A G 1: 159,715,892 (GRCm39) S885G probably benign Het
Trak2 T C 1: 58,960,966 (GRCm39) D188G probably damaging Het
Tubb1 A G 2: 174,299,562 (GRCm39) I415V probably benign Het
Virma T A 4: 11,542,154 (GRCm39) M1580K probably benign Het
Vmn1r120 A T 7: 20,786,934 (GRCm39) I259N possibly damaging Het
Vmn1r64 G A 7: 5,887,522 (GRCm39) T7I probably benign Het
Other mutations in Synpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Synpo2 APN 3 122,906,859 (GRCm39) missense probably damaging 1.00
IGL00742:Synpo2 APN 3 122,907,525 (GRCm39) missense probably damaging 1.00
IGL01890:Synpo2 APN 3 122,906,146 (GRCm39) missense probably damaging 1.00
IGL02268:Synpo2 APN 3 122,910,632 (GRCm39) missense probably damaging 1.00
IGL02323:Synpo2 APN 3 122,911,183 (GRCm39) missense probably benign 0.00
IGL02745:Synpo2 APN 3 122,907,261 (GRCm39) missense probably damaging 1.00
IGL03001:Synpo2 APN 3 122,873,604 (GRCm39) missense probably benign 0.00
IGL03177:Synpo2 APN 3 122,914,864 (GRCm39) missense probably damaging 1.00
IGL03336:Synpo2 APN 3 122,907,828 (GRCm39) missense possibly damaging 0.60
R0086:Synpo2 UTSW 3 122,910,753 (GRCm39) nonsense probably null
R0126:Synpo2 UTSW 3 122,873,511 (GRCm39) missense possibly damaging 0.71
R0227:Synpo2 UTSW 3 122,907,442 (GRCm39) missense probably benign 0.02
R0284:Synpo2 UTSW 3 122,873,383 (GRCm39) nonsense probably null
R0388:Synpo2 UTSW 3 122,873,546 (GRCm39) missense probably benign
R0457:Synpo2 UTSW 3 122,906,421 (GRCm39) missense probably damaging 1.00
R0483:Synpo2 UTSW 3 122,907,981 (GRCm39) missense probably damaging 1.00
R0615:Synpo2 UTSW 3 122,910,936 (GRCm39) missense probably damaging 1.00
R0646:Synpo2 UTSW 3 122,908,098 (GRCm39) missense probably damaging 1.00
R0666:Synpo2 UTSW 3 122,907,708 (GRCm39) missense probably damaging 0.98
R0743:Synpo2 UTSW 3 122,906,355 (GRCm39) missense probably benign 0.02
R0791:Synpo2 UTSW 3 122,906,835 (GRCm39) missense probably benign
R1531:Synpo2 UTSW 3 122,911,315 (GRCm39) missense probably benign 0.03
R1587:Synpo2 UTSW 3 122,908,047 (GRCm39) missense probably damaging 0.98
R1717:Synpo2 UTSW 3 122,906,203 (GRCm39) missense probably damaging 1.00
R1807:Synpo2 UTSW 3 122,873,906 (GRCm39) missense possibly damaging 0.71
R2114:Synpo2 UTSW 3 122,873,537 (GRCm39) missense probably benign 0.01
R2987:Synpo2 UTSW 3 122,910,622 (GRCm39) missense probably damaging 1.00
R3019:Synpo2 UTSW 3 122,907,228 (GRCm39) missense probably damaging 1.00
R3939:Synpo2 UTSW 3 122,908,239 (GRCm39) missense probably damaging 1.00
R4050:Synpo2 UTSW 3 122,907,927 (GRCm39) missense possibly damaging 0.81
R4119:Synpo2 UTSW 3 122,910,799 (GRCm39) missense probably damaging 1.00
R4669:Synpo2 UTSW 3 122,906,712 (GRCm39) missense probably damaging 1.00
R4724:Synpo2 UTSW 3 122,907,940 (GRCm39) missense probably damaging 1.00
R4825:Synpo2 UTSW 3 122,908,068 (GRCm39) missense probably damaging 0.98
R5152:Synpo2 UTSW 3 123,029,550 (GRCm39) critical splice donor site probably null
R5292:Synpo2 UTSW 3 122,907,709 (GRCm39) missense possibly damaging 0.51
R5396:Synpo2 UTSW 3 122,911,331 (GRCm39) nonsense probably null
R5701:Synpo2 UTSW 3 122,873,879 (GRCm39) missense probably damaging 1.00
R5712:Synpo2 UTSW 3 122,914,859 (GRCm39) missense probably damaging 1.00
R5879:Synpo2 UTSW 3 122,907,946 (GRCm39) missense probably damaging 1.00
R5979:Synpo2 UTSW 3 122,911,060 (GRCm39) missense probably damaging 1.00
R6290:Synpo2 UTSW 3 122,910,701 (GRCm39) missense probably damaging 0.98
R6384:Synpo2 UTSW 3 122,906,698 (GRCm39) nonsense probably null
R6498:Synpo2 UTSW 3 122,873,881 (GRCm39) splice site probably null
R7123:Synpo2 UTSW 3 122,906,835 (GRCm39) missense probably benign
R7153:Synpo2 UTSW 3 122,906,053 (GRCm39) makesense probably null
R7233:Synpo2 UTSW 3 122,911,333 (GRCm39) missense probably benign 0.01
R7301:Synpo2 UTSW 3 122,907,702 (GRCm39) missense probably benign 0.10
R7318:Synpo2 UTSW 3 122,910,968 (GRCm39) missense probably benign
R7366:Synpo2 UTSW 3 122,907,690 (GRCm39) missense probably damaging 0.96
R7630:Synpo2 UTSW 3 122,873,681 (GRCm39) missense probably damaging 1.00
R7962:Synpo2 UTSW 3 123,029,635 (GRCm39) missense probably benign 0.09
R8068:Synpo2 UTSW 3 122,911,041 (GRCm39) missense possibly damaging 0.59
R8335:Synpo2 UTSW 3 122,908,183 (GRCm39) missense probably damaging 1.00
R9066:Synpo2 UTSW 3 122,911,133 (GRCm39) missense possibly damaging 0.66
R9269:Synpo2 UTSW 3 122,910,973 (GRCm39) missense probably benign 0.00
R9318:Synpo2 UTSW 3 122,873,705 (GRCm39) missense probably damaging 1.00
R9623:Synpo2 UTSW 3 122,908,047 (GRCm39) missense possibly damaging 0.68
R9685:Synpo2 UTSW 3 122,911,366 (GRCm39) missense probably damaging 1.00
Z1177:Synpo2 UTSW 3 122,906,659 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATAGGGAACATCCTCTGGGC -3'
(R):5'- TTGCTGTCTGACGTTGACGAC -3'

Sequencing Primer
(F):5'- AACATCCTCTGGGCCCCTG -3'
(R):5'- GAACTTTGATTGGGATTCTGGAC -3'
Posted On 2017-01-03