Incidental Mutation 'R5730:Tcea3'
ID452708
Institutional Source Beutler Lab
Gene Symbol Tcea3
Ensembl Gene ENSMUSG00000001604
Gene Nametranscription elongation factor A (SII), 3
SynonymsS-II
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136247729-136274898 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136264893 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 209 (V209A)
Ref Sequence ENSEMBL: ENSMUSP00000099592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102533] [ENSMUST00000143942]
PDB Structure
Solution structure of the N-terminal Domain I of mouse transcription elongation factor S-II protein 3 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000102533
AA Change: V209A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099592
Gene: ENSMUSG00000001604
AA Change: V209A

DomainStartEndE-ValueType
TFS2N 7 81 1.43e-29 SMART
low complexity region 86 100 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
TFS2M 184 285 1.05e-52 SMART
ZnF_C2C2 307 346 6.87e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136812
Predicted Effect probably benign
Transcript: ENSMUST00000143942
SMART Domains Protein: ENSMUSP00000122718
Gene: ENSMUSG00000001604

DomainStartEndE-ValueType
TFS2N 7 81 1.41e-28 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 148 168 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Tcea3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Tcea3 APN 4 136273692 missense probably damaging 1.00
IGL01647:Tcea3 APN 4 136274776 splice site probably benign
IGL02153:Tcea3 APN 4 136273634 splice site probably benign
IGL02832:Tcea3 APN 4 136268113 missense probably damaging 1.00
IGL02951:Tcea3 APN 4 136257988 critical splice donor site probably null
R0281:Tcea3 UTSW 4 136271366 missense probably damaging 1.00
R0646:Tcea3 UTSW 4 136248071 nonsense probably null
R3937:Tcea3 UTSW 4 136255143 splice site probably benign
R4944:Tcea3 UTSW 4 136268093 missense probably damaging 1.00
R5028:Tcea3 UTSW 4 136257935 missense possibly damaging 0.87
R5169:Tcea3 UTSW 4 136264870 critical splice acceptor site probably null
R5245:Tcea3 UTSW 4 136264502 missense probably benign 0.01
R5511:Tcea3 UTSW 4 136271372 missense probably damaging 1.00
R6208:Tcea3 UTSW 4 136248049 start codon destroyed probably damaging 0.96
R7106:Tcea3 UTSW 4 136271368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTGTGGAGATGCTGTCAGC -3'
(R):5'- CCAAGAGCAATGTCAGCTGC -3'

Sequencing Primer
(F):5'- CAGCAGCTCTGAAGGCAG -3'
(R):5'- AATGTCAGCTGCGCTCAG -3'
Posted On2017-01-03