Incidental Mutation 'R0553:Cd40'
ID 45271
Institutional Source Beutler Lab
Gene Symbol Cd40
Ensembl Gene ENSMUSG00000017652
Gene Name CD40 antigen
Synonyms Bp50, Cd40, p50, Tnfrsf5
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 165055627-165072948 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 165070741 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 204 (R204Q)
Ref Sequence ENSEMBL: ENSMUSP00000073386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017799] [ENSMUST00000073707] [ENSMUST00000081310] [ENSMUST00000184221]
AlphaFold P27512
Predicted Effect probably benign
Transcript: ENSMUST00000017799
AA Change: R233Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652
AA Change: R233Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073707
AA Change: R204Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652
AA Change: R204Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081310
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153105
Predicted Effect probably benign
Transcript: ENSMUST00000184221
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Cd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 165062301 missense probably benign 0.23
noelle UTSW 2 165063563 critical splice donor site probably null
R1115:Cd40 UTSW 2 165070761 missense possibly damaging 0.59
R1134:Cd40 UTSW 2 165070818 missense probably benign 0.44
R2036:Cd40 UTSW 2 165062301 missense probably benign 0.23
R2938:Cd40 UTSW 2 165069702 missense probably benign 0.01
R3034:Cd40 UTSW 2 165062315 missense probably benign 0.02
R4690:Cd40 UTSW 2 165069695 missense possibly damaging 0.68
R5222:Cd40 UTSW 2 165066544 missense probably benign 0.41
R5310:Cd40 UTSW 2 165063563 critical splice donor site probably null
R7318:Cd40 UTSW 2 165062335 missense possibly damaging 0.51
R7833:Cd40 UTSW 2 165066511 missense probably benign 0.01
R7905:Cd40 UTSW 2 165062325 missense probably damaging 1.00
R8069:Cd40 UTSW 2 165056775 missense unknown
R8371:Cd40 UTSW 2 165066538 missense probably damaging 1.00
R9177:Cd40 UTSW 2 165063545 missense probably damaging 1.00
R9224:Cd40 UTSW 2 165056796 missense unknown
R9311:Cd40 UTSW 2 165070747 missense possibly damaging 0.87
Z1088:Cd40 UTSW 2 165063040 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGAAACTCTGGCTGTGCTTTCCTC -3'
(R):5'- CAAGGCTATGCTGTCTGTCACCTG -3'

Sequencing Primer
(F):5'- CCAAATTTCATGTGTCCAGCAGG -3'
(R):5'- GTCACCTGCCGCTCCTG -3'
Posted On 2013-06-11