Incidental Mutation 'R5730:Olfr450'
ID452712
Institutional Source Beutler Lab
Gene Symbol Olfr450
Ensembl Gene ENSMUSG00000054431
Gene Nameolfactory receptor 450
SynonymsMOR257-3, GA_x6K02T2P3E9-4742413-4741481
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42811939-42819081 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 42818160 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 230 (R230*)
Ref Sequence ENSEMBL: ENSMUSP00000151908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067503] [ENSMUST00000218832]
Predicted Effect probably null
Transcript: ENSMUST00000067503
AA Change: R230*
SMART Domains Protein: ENSMUSP00000068823
Gene: ENSMUSG00000054431
AA Change: R230*

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 8.2e-49 PFAM
Pfam:7tm_1 43 291 1.2e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000218832
AA Change: R230*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Olfr450
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Olfr450 APN 6 42818274 missense probably damaging 0.99
IGL01720:Olfr450 APN 6 42817593 missense probably benign 0.00
IGL02457:Olfr450 APN 6 42818242 missense probably damaging 0.97
R0376:Olfr450 UTSW 6 42818292 missense probably benign 0.00
R1804:Olfr450 UTSW 6 42818221 missense possibly damaging 0.66
R1823:Olfr450 UTSW 6 42818268 missense possibly damaging 0.49
R2115:Olfr450 UTSW 6 42817497 missense possibly damaging 0.65
R4817:Olfr450 UTSW 6 42817962 missense possibly damaging 0.78
R5938:Olfr450 UTSW 6 42817767 missense probably damaging 1.00
R6514:Olfr450 UTSW 6 42817996 missense probably damaging 0.97
R7050:Olfr450 UTSW 6 42817570 missense possibly damaging 0.61
R7211:Olfr450 UTSW 6 42818016 missense probably benign 0.41
Z1177:Olfr450 UTSW 6 42818199 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGTCATCAATCACTTTGCCTGTG -3'
(R):5'- AACAAGTTTTGTAAGAGCAGCC -3'

Sequencing Primer
(F):5'- GTGAGACCCTTGCAGTGCTTC -3'
(R):5'- TGTAGATCACAGGGTTCAACGTG -3'
Posted On2017-01-03