Incidental Mutation 'R5730:Klk11'
ID452716
Institutional Source Beutler Lab
Gene Symbol Klk11
Ensembl Gene ENSMUSG00000067616
Gene Namekallikrein related-peptidase 11
Synonymshippostasin, Prss20, TLSP
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location43774604-43779263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43774775 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 6 (S6N)
Ref Sequence ENSEMBL: ENSMUSP00000079101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014063] [ENSMUST00000080211] [ENSMUST00000107970] [ENSMUST00000171458]
Predicted Effect probably benign
Transcript: ENSMUST00000014063
SMART Domains Protein: ENSMUSP00000014063
Gene: ENSMUSG00000044430

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 21 240 1.3e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080211
AA Change: S6N

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079101
Gene: ENSMUSG00000067616
AA Change: S6N

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
Tryp_SPc 47 269 5.14e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107970
SMART Domains Protein: ENSMUSP00000103604
Gene: ENSMUSG00000044430

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 21 240 1.3e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171458
SMART Domains Protein: ENSMUSP00000132721
Gene: ENSMUSG00000067616

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 20 242 5.14e-95 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206165
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Klk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02900:Klk11 APN 7 43778413 missense probably damaging 0.97
IGL03090:Klk11 APN 7 43777553 missense probably benign 0.00
aceto UTSW 7 43774774 missense probably benign 0.18
sotto UTSW 7 43778912 missense probably damaging 0.99
R0326:Klk11 UTSW 7 43776519 start codon destroyed probably null 0.01
R1370:Klk11 UTSW 7 43776907 missense probably benign 0.03
R1503:Klk11 UTSW 7 43778909 nonsense probably null
R1812:Klk11 UTSW 7 43777755 critical splice donor site probably null
R3003:Klk11 UTSW 7 43776995 missense probably damaging 0.99
R4974:Klk11 UTSW 7 43777736 missense probably damaging 0.98
R5654:Klk11 UTSW 7 43778386 missense probably damaging 1.00
R6602:Klk11 UTSW 7 43774774 missense probably benign 0.18
R6834:Klk11 UTSW 7 43778912 missense probably damaging 0.99
R7310:Klk11 UTSW 7 43778830 missense probably damaging 0.99
R7741:Klk11 UTSW 7 43776997 missense probably benign 0.03
Z1177:Klk11 UTSW 7 43778335 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GATGGTAGCCTTTTCCAACATC -3'
(R):5'- AATCTGGGGCGTCATAGAGG -3'

Sequencing Primer
(F):5'- TAGAGAACTGAGCTTCCCTGG -3'
(R):5'- CGTCATAGAGGTGGGGCTGC -3'
Posted On2017-01-03