Incidental Mutation 'R5730:Gm1553'
ID452726
Institutional Source Beutler Lab
Gene Symbol Gm1553
Ensembl Gene ENSMUSG00000094186
Gene Namepredicted gene 1553
SynonymsLcrn, LOC380643
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location82486537-82492618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82488111 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 94 (F94S)
Ref Sequence ENSEMBL: ENSMUSP00000135907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177934]
Predicted Effect unknown
Transcript: ENSMUST00000177934
AA Change: F94S
SMART Domains Protein: ENSMUSP00000135907
Gene: ENSMUSG00000094186
AA Change: F94S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Gm1553
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0393:Gm1553 UTSW 10 82492176 missense unknown
R1613:Gm1553 UTSW 10 82492596 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTAGCAGTAGATTACATTGGAGTACC -3'
(R):5'- GCAGGTTCTACATTCTTTCATAGAC -3'

Sequencing Primer
(F):5'- ggagtaatcttctggattaatg -3'
(R):5'- CTATATAAAAGCCTTAGAGAGC -3'
Posted On2017-01-03