Incidental Mutation 'R5730:Syne3'
ID452730
Institutional Source Beutler Lab
Gene Symbol Syne3
Ensembl Gene ENSMUSG00000054150
Gene Namespectrin repeat containing, nuclear envelope family member 3
Synonyms4831426I19Rik, nesprin-3, nesprin-3alpha, nesprin-3beta
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104929933-105009809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104961454 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 250 (I250V)
Ref Sequence ENSEMBL: ENSMUSP00000105553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067005] [ENSMUST00000095439] [ENSMUST00000109927]
Predicted Effect probably benign
Transcript: ENSMUST00000067005
AA Change: I250V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000065771
Gene: ENSMUSG00000054150
AA Change: I250V

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095439
AA Change: I337V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093090
Gene: ENSMUSG00000054150
AA Change: I337V

DomainStartEndE-ValueType
SPEC 7 109 1.22e-1 SMART
SPEC 223 324 1.01e-1 SMART
Blast:SPEC 339 533 2e-54 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 582 601 N/A INTRINSIC
SPEC 650 751 1.74e-1 SMART
Blast:SPEC 809 905 1e-12 BLAST
KASH 919 975 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109927
AA Change: I250V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105553
Gene: ENSMUSG00000054150
AA Change: I250V

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Syne3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Syne3 APN 12 104958069 missense probably benign 0.00
IGL01986:Syne3 APN 12 104968000 missense probably damaging 1.00
IGL02303:Syne3 APN 12 104963294 missense probably damaging 1.00
IGL02469:Syne3 APN 12 104954306 missense probably benign 0.08
IGL03127:Syne3 APN 12 104943428 missense probably benign 0.02
PIT4791001:Syne3 UTSW 12 104963179 missense probably benign
R0436:Syne3 UTSW 12 104946924 missense possibly damaging 0.95
R0471:Syne3 UTSW 12 104943426 missense probably benign 0.00
R0613:Syne3 UTSW 12 104958112 missense probably benign
R0662:Syne3 UTSW 12 104961510 missense probably benign 0.44
R0707:Syne3 UTSW 12 104969360 missense probably damaging 0.98
R1321:Syne3 UTSW 12 104975796 missense probably benign 0.14
R1494:Syne3 UTSW 12 104955582 missense possibly damaging 0.87
R2035:Syne3 UTSW 12 104958127 missense probably benign 0.00
R2147:Syne3 UTSW 12 104953098 missense probably damaging 1.00
R2326:Syne3 UTSW 12 104969234 missense probably damaging 1.00
R2923:Syne3 UTSW 12 104968084 missense probably damaging 1.00
R3710:Syne3 UTSW 12 104943438 missense possibly damaging 0.86
R3946:Syne3 UTSW 12 104958066 missense probably damaging 1.00
R4542:Syne3 UTSW 12 104969244 missense probably benign 0.00
R4544:Syne3 UTSW 12 104959469 missense probably damaging 1.00
R5110:Syne3 UTSW 12 104943370 missense probably benign 0.10
R5256:Syne3 UTSW 12 104975880 start codon destroyed probably null 1.00
R5490:Syne3 UTSW 12 104955672 missense probably damaging 1.00
R5616:Syne3 UTSW 12 104955678 missense probably damaging 1.00
R5941:Syne3 UTSW 12 104946992 missense probably benign
R6208:Syne3 UTSW 12 104943363 missense probably benign 0.12
R6456:Syne3 UTSW 12 104940704 missense possibly damaging 0.87
R6566:Syne3 UTSW 12 104946707 missense probably benign 0.00
R6957:Syne3 UTSW 12 104954302 missense probably damaging 1.00
R7251:Syne3 UTSW 12 104961571 frame shift probably null
R7388:Syne3 UTSW 12 104967908 missense probably damaging 1.00
R7591:Syne3 UTSW 12 104940604 critical splice donor site probably null
R7614:Syne3 UTSW 12 104946642 missense not run
R7740:Syne3 UTSW 12 104954287 missense probably benign 0.01
R7763:Syne3 UTSW 12 104997495 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGCCAAAGAATCAAGCATATC -3'
(R):5'- ACAGGCTGTGGGTGTCATTC -3'

Sequencing Primer
(F):5'- AAGGCCTCTCTGCGATTATG -3'
(R):5'- GCTGTGGGTGTCATTCAAAACAC -3'
Posted On2017-01-03