Incidental Mutation 'R5730:Brd1'
ID452732
Institutional Source Beutler Lab
Gene Symbol Brd1
Ensembl Gene ENSMUSG00000022387
Gene Namebromodomain containing 1
Synonyms1110059H06Rik
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location88687034-88734233 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 88717045 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 462 (N462T)
Ref Sequence ENSEMBL: ENSMUSP00000105007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088911] [ENSMUST00000109380] [ENSMUST00000109381]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000088911
SMART Domains Protein: ENSMUSP00000086300
Gene: ENSMUSG00000022387

DomainStartEndE-ValueType
Pfam:EPL1 46 196 1.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109380
AA Change: N462T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105006
Gene: ENSMUSG00000022387
AA Change: N462T

DomainStartEndE-ValueType
Pfam:EPL1 46 196 3.3e-38 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 836 869 N/A INTRINSIC
PWWP 927 1010 2.25e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109381
AA Change: N462T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105007
Gene: ENSMUSG00000022387
AA Change: N462T

DomainStartEndE-ValueType
Pfam:EPL1 47 196 3.9e-37 PFAM
PHD 216 262 3.17e-7 SMART
PHD 326 389 5.16e-7 SMART
low complexity region 415 436 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
low complexity region 532 551 N/A INTRINSIC
BROMO 560 668 8.59e-39 SMART
coiled coil region 704 726 N/A INTRINSIC
low complexity region 857 876 N/A INTRINSIC
low complexity region 887 898 N/A INTRINSIC
low complexity region 967 1000 N/A INTRINSIC
PWWP 1058 1141 2.25e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156155
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that localizes to the nucleus and can interact with DNA and histone tails. The encoded protein is a component of the MOZ/MORF acetyltransferase complex and can stimulate acetylation of histones H3 and H4, thereby potentially playing a role in gene activation. Variation in this gene is associated with schozophrenia and bipolar disorder in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal letahlity associated with severe growth retardation, abnormal lens, anemia, and impaired fetal hematopoiesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Clip4 A G 17: 71,810,959 Y333C probably damaging Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Brd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Brd1 APN 15 88730158 missense probably benign 0.38
IGL00924:Brd1 APN 15 88729409 missense possibly damaging 0.80
IGL01626:Brd1 APN 15 88700887 missense probably damaging 1.00
IGL02569:Brd1 APN 15 88713929 missense probably damaging 1.00
IGL02646:Brd1 APN 15 88700877 missense probably damaging 1.00
IGL03130:Brd1 APN 15 88688374 missense probably benign
IGL03343:Brd1 APN 15 88707251 missense possibly damaging 0.89
spry UTSW 15 88688355 missense possibly damaging 0.47
R0089:Brd1 UTSW 15 88701198 missense probably benign 0.06
R0112:Brd1 UTSW 15 88730383 missense probably benign
R0165:Brd1 UTSW 15 88729777 missense probably damaging 0.99
R0965:Brd1 UTSW 15 88717028 missense probably damaging 1.00
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1195:Brd1 UTSW 15 88700811 missense probably benign 0.12
R1534:Brd1 UTSW 15 88689663 missense possibly damaging 0.68
R2245:Brd1 UTSW 15 88689860 critical splice donor site probably null
R3611:Brd1 UTSW 15 88700944 missense probably benign
R3751:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3752:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3753:Brd1 UTSW 15 88689618 missense possibly damaging 0.83
R3801:Brd1 UTSW 15 88717040 missense probably damaging 1.00
R4956:Brd1 UTSW 15 88730113 missense probably damaging 1.00
R5382:Brd1 UTSW 15 88729564 missense probably damaging 1.00
R5546:Brd1 UTSW 15 88701122 missense probably benign 0.00
R5659:Brd1 UTSW 15 88713381 missense probably benign 0.14
R5773:Brd1 UTSW 15 88689549 missense probably benign 0.14
R6224:Brd1 UTSW 15 88688355 missense possibly damaging 0.47
R6371:Brd1 UTSW 15 88713998 missense probably benign
R7096:Brd1 UTSW 15 88713935 missense probably damaging 1.00
R7722:Brd1 UTSW 15 88729559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAGGGTCAGCAGCACATC -3'
(R):5'- GAACCTGGTGACTCTTGTGG -3'

Sequencing Primer
(F):5'- AGCAGCACATCCAGCCTGG -3'
(R):5'- TGACTCTTGTGGAGGATGAAATC -3'
Posted On2017-01-03