Incidental Mutation 'R5730:Clip4'
ID452736
Institutional Source Beutler Lab
Gene Symbol Clip4
Ensembl Gene ENSMUSG00000024059
Gene NameCAP-GLY domain containing linker protein family, member 4
Synonyms1700024K14Rik, Rsnl2, 1700074B05Rik, 4833417L20Rik, 5830409B12Rik
MMRRC Submission 043191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5730 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71768473-71864273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71810959 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 333 (Y333C)
Ref Sequence ENSEMBL: ENSMUSP00000155844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024854] [ENSMUST00000229304] [ENSMUST00000229874] [ENSMUST00000229952] [ENSMUST00000230305] [ENSMUST00000230333] [ENSMUST00000230747] [ENSMUST00000230749] [ENSMUST00000231105]
Predicted Effect probably damaging
Transcript: ENSMUST00000024854
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024854
Gene: ENSMUSG00000024059
AA Change: Y333C

DomainStartEndE-ValueType
ANK 106 144 4.58e2 SMART
ANK 149 180 3.26e0 SMART
ANK 186 215 3.26e0 SMART
CAP_GLY 285 350 6.63e-34 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 469 478 N/A INTRINSIC
CAP_GLY 486 551 5.52e-31 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
CAP_GLY 624 690 5.65e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229304
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000229874
AA Change: Y333C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000229952
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000230160
AA Change: Y25C
Predicted Effect probably damaging
Transcript: ENSMUST00000230305
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230333
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230700
Predicted Effect probably damaging
Transcript: ENSMUST00000230747
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230749
AA Change: Y333C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000231105
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,010,253 V2967A possibly damaging Het
Apaf1 A T 10: 91,020,771 I858K possibly damaging Het
Baiap3 T C 17: 25,247,524 T466A probably benign Het
Brca2 T A 5: 150,569,005 S3162T possibly damaging Het
Brd1 T G 15: 88,717,045 N462T probably benign Het
Carm1 G A 9: 21,580,340 R235H probably benign Het
Cd80 T C 16: 38,482,735 probably null Het
Col7a1 T C 9: 108,972,242 probably null Het
Csmd1 G A 8: 16,185,192 Q1206* probably null Het
Cyp17a1 A G 19: 46,672,656 I63T possibly damaging Het
Diaph1 A G 18: 37,903,776 Y119H unknown Het
Dst T G 1: 34,117,526 probably null Het
Fgfr1 A G 8: 25,573,811 T785A probably damaging Het
Gm1553 A G 10: 82,488,111 F94S unknown Het
Gpbar1 A G 1: 74,279,036 N146S probably damaging Het
Gpc5 A G 14: 115,788,314 T588A possibly damaging Het
Gramd2 A G 9: 59,711,206 H9R probably damaging Het
Klk11 G A 7: 43,774,775 S6N probably benign Het
Lrp1 A G 10: 127,583,834 S969P probably benign Het
Lyz2 G T 10: 117,278,682 A114E probably damaging Het
Madd T C 2: 91,158,109 D1193G probably damaging Het
Mrpl39 C T 16: 84,732,434 G107R probably damaging Het
Mthfd2 C T 6: 83,317,459 R24H probably benign Het
Olfr1240 T C 2: 89,439,436 N281S probably damaging Het
Olfr450 C T 6: 42,818,160 R230* probably null Het
Ovch2 A G 7: 107,793,399 C246R probably damaging Het
Phf14 A T 6: 11,953,320 I353F possibly damaging Het
Ppp2r5a C T 1: 191,372,535 V105I probably benign Het
Prr14l T C 5: 32,793,603 T1949A probably damaging Het
Prss48 T G 3: 85,997,256 M212L possibly damaging Het
Pstk A T 7: 131,373,774 D152V probably damaging Het
Scn2a C A 2: 65,682,538 S214* probably null Het
Scn3a T G 2: 65,495,260 N971T probably benign Het
Syne3 T C 12: 104,961,454 I250V probably benign Het
Synpo2 T C 3: 123,114,119 D516G probably benign Het
Tcea3 T C 4: 136,264,893 V209A probably benign Het
Tnr A G 1: 159,888,322 S885G probably benign Het
Trak2 T C 1: 58,921,807 D188G probably damaging Het
Tubb1 A G 2: 174,457,769 I415V probably benign Het
Virma T A 4: 11,542,154 M1580K probably benign Het
Vmn1r120 A T 7: 21,053,009 I259N possibly damaging Het
Vmn1r64 G A 7: 5,884,523 T7I probably benign Het
Other mutations in Clip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Clip4 APN 17 71849942 missense probably damaging 1.00
IGL01011:Clip4 APN 17 71849939 missense probably benign 0.02
IGL01086:Clip4 APN 17 71824794 missense probably benign 0.00
IGL01712:Clip4 APN 17 71799041 missense probably damaging 1.00
IGL01833:Clip4 APN 17 71827790 unclassified probably benign
IGL02150:Clip4 APN 17 71799076 missense probably damaging 1.00
IGL02378:Clip4 APN 17 71837726 missense possibly damaging 0.94
IGL02597:Clip4 APN 17 71849970 splice site probably benign
IGL02676:Clip4 APN 17 71828621 missense probably damaging 1.00
PIT4243001:Clip4 UTSW 17 71806728 missense probably damaging 0.98
R0525:Clip4 UTSW 17 71799098 critical splice donor site probably null
R0737:Clip4 UTSW 17 71837699 nonsense probably null
R1791:Clip4 UTSW 17 71801942 splice site probably benign
R1908:Clip4 UTSW 17 71837749 missense probably damaging 1.00
R2290:Clip4 UTSW 17 71810953 missense possibly damaging 0.96
R3701:Clip4 UTSW 17 71799008 missense probably damaging 0.96
R4001:Clip4 UTSW 17 71799076 missense probably damaging 1.00
R4013:Clip4 UTSW 17 71856546 nonsense probably null
R4589:Clip4 UTSW 17 71810867 nonsense probably null
R4837:Clip4 UTSW 17 71834222 missense probably damaging 1.00
R5174:Clip4 UTSW 17 71810962 missense probably damaging 1.00
R5239:Clip4 UTSW 17 71799077 missense probably damaging 1.00
R5298:Clip4 UTSW 17 71834225 missense probably damaging 1.00
R5535:Clip4 UTSW 17 71831262 missense probably benign
R5667:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5671:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5768:Clip4 UTSW 17 71806499 splice site probably null
R5913:Clip4 UTSW 17 71824765 missense probably benign 0.00
R5974:Clip4 UTSW 17 71831247 missense probably damaging 1.00
R5996:Clip4 UTSW 17 71856310 missense probably damaging 0.99
R6176:Clip4 UTSW 17 71806633 nonsense probably null
R6371:Clip4 UTSW 17 71856464 missense probably damaging 1.00
R6386:Clip4 UTSW 17 71834194 nonsense probably null
R7296:Clip4 UTSW 17 71790001 missense probably damaging 0.99
R7546:Clip4 UTSW 17 71828702 missense possibly damaging 0.85
R7548:Clip4 UTSW 17 71789968 missense probably benign
R7616:Clip4 UTSW 17 71834273 missense probably benign 0.00
R8054:Clip4 UTSW 17 71834273 missense possibly damaging 0.68
R8056:Clip4 UTSW 17 71803592 missense probably damaging 1.00
Z1177:Clip4 UTSW 17 71799097 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAAGAACTTTACCTGGGAAGGATTC -3'
(R):5'- AGCAGCCTCTCTAGCATTCC -3'

Sequencing Primer
(F):5'- GAAGGATTCCATGTCTTTCTGAC -3'
(R):5'- TCTAGCATTCCCATCAGTGTAAAC -3'
Posted On2017-01-03