Incidental Mutation 'R0553:Gm7534'
ID 45274
Institutional Source Beutler Lab
Gene Symbol Gm7534
Ensembl Gene ENSMUSG00000073747
Gene Name predicted gene 7534
Synonyms
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 134190804-134203004 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 134202518 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 159 (T159A)
Ref Sequence ENSEMBL: ENSMUSP00000095461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097849]
AlphaFold Q3UU21
Predicted Effect possibly damaging
Transcript: ENSMUST00000097849
AA Change: T159A

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095461
Gene: ENSMUSG00000073747
AA Change: T159A

DomainStartEndE-ValueType
low complexity region 1 16 N/A INTRINSIC
internal_repeat_1 21 111 5.47e-40 PROSPERO
low complexity region 112 143 N/A INTRINSIC
low complexity region 158 177 N/A INTRINSIC
internal_repeat_1 181 271 5.47e-40 PROSPERO
low complexity region 322 334 N/A INTRINSIC
ZP 368 618 3.21e-13 SMART
low complexity region 650 668 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122228
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Gm7534
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Gm7534 APN 4 134201980 missense probably benign 0.27
IGL03170:Gm7534 APN 4 134193034 missense possibly damaging 0.57
FR4342:Gm7534 UTSW 4 134202631 small insertion probably benign
FR4976:Gm7534 UTSW 4 134202630 small insertion probably benign
R0487:Gm7534 UTSW 4 134202778 missense probably damaging 0.97
R0530:Gm7534 UTSW 4 134202910 missense probably benign
R1121:Gm7534 UTSW 4 134202937 missense probably benign 0.00
R1458:Gm7534 UTSW 4 134196833 missense probably benign 0.01
R1748:Gm7534 UTSW 4 134200299 missense probably damaging 1.00
R1748:Gm7534 UTSW 4 134202119 missense possibly damaging 0.57
R1913:Gm7534 UTSW 4 134192675 critical splice donor site probably null
R2029:Gm7534 UTSW 4 134202358 missense possibly damaging 0.87
R2069:Gm7534 UTSW 4 134201941 missense possibly damaging 0.63
R2237:Gm7534 UTSW 4 134202205 missense unknown
R2239:Gm7534 UTSW 4 134202205 missense unknown
R3943:Gm7534 UTSW 4 134200345 missense probably benign 0.15
R4646:Gm7534 UTSW 4 134202148 missense probably benign 0.00
R4673:Gm7534 UTSW 4 134200347 missense probably benign 0.01
R4838:Gm7534 UTSW 4 134193099 missense probably benign 0.04
R5002:Gm7534 UTSW 4 134196920 missense probably benign 0.09
R5593:Gm7534 UTSW 4 134193039 missense probably damaging 0.99
R5606:Gm7534 UTSW 4 134200212 missense probably benign 0.13
R6553:Gm7534 UTSW 4 134202056 missense probably damaging 0.99
R6834:Gm7534 UTSW 4 134193165 missense possibly damaging 0.95
R6931:Gm7534 UTSW 4 134193153 missense probably benign 0.28
R7526:Gm7534 UTSW 4 134200073 splice site probably null
R7771:Gm7534 UTSW 4 134195443 missense probably benign 0.01
R8271:Gm7534 UTSW 4 134202967 missense unknown
R8725:Gm7534 UTSW 4 134202839 missense probably benign 0.19
R8727:Gm7534 UTSW 4 134202839 missense probably benign 0.19
R8757:Gm7534 UTSW 4 134202971 missense unknown
R8966:Gm7534 UTSW 4 134202401 missense probably damaging 0.98
R8992:Gm7534 UTSW 4 134202667 missense probably damaging 0.99
R9039:Gm7534 UTSW 4 134195547 missense probably damaging 0.98
R9275:Gm7534 UTSW 4 134195459 missense probably damaging 1.00
R9278:Gm7534 UTSW 4 134195459 missense probably damaging 1.00
R9434:Gm7534 UTSW 4 134202242 missense probably benign 0.01
RF015:Gm7534 UTSW 4 134193027 missense probably benign
T0975:Gm7534 UTSW 4 134202629 small insertion probably benign
Z1176:Gm7534 UTSW 4 134200338 missense possibly damaging 0.90
Z1176:Gm7534 UTSW 4 134202677 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGGGCTGTAGAATGGTCCGATG -3'
(R):5'- ACAATGAGTATGTCACCTGGCACAC -3'

Sequencing Primer
(F):5'- GCACAGTGGTCCTCAGATTAG -3'
(R):5'- CTGGCACACACCACAGC -3'
Posted On 2013-06-11