Mutagenetix > Incidental Mutation

Incidental Mutation 'R0553:Kdm1a'

45275

Institutional Source

Beutler Lab

Gene Symbol

Kdm1a

Ensembl Gene

ENSMUSG00000036940

Gene Name

lysine (K)-specific demethylase 1A

Synonyms

Aof2, 1810043O07Rik, Kdm1, LSD1

MMRRC Submission

038745-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0553 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

136550540-136602723 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 136555298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 229 (D229G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105847] [ENSMUST00000116273] [ENSMUST00000168936]

AlphaFold

Q6ZQ88

Predicted Effect

probably damaging
Transcript: ENSMUST00000046846
AA Change: D387G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000035457
Gene: ENSMUSG00000036940
AA Change: D387G

Domain	Start	End	E-Value	Type
low complexity region	47	80	N/A	INTRINSIC
Pfam:SWIRM	85	173	1.1e-20	PFAM
Pfam:AlaDh_PNT_C	181	297	8.4e-8	PFAM
Pfam:FAD_binding_2	189	236	1.6e-6	PFAM
Pfam:Pyr_redox	189	237	6.5e-7	PFAM
Pfam:DAO	189	457	1.5e-9	PFAM
Pfam:NAD_binding_8	192	256	9e-16	PFAM
Pfam:Amino_oxidase	197	657	7e-133	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105847
AA Change: D578G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101473
Gene: ENSMUSG00000036940
AA Change: D578G

Domain	Start	End	E-Value	Type
low complexity region	7	40	N/A	INTRINSIC
low complexity region	76	97	N/A	INTRINSIC
low complexity region	139	172	N/A	INTRINSIC
low complexity region	177	194	N/A	INTRINSIC
Pfam:SWIRM	197	285	8.8e-21	PFAM
Pfam:FAD_binding_2	301	348	6e-6	PFAM
Pfam:Pyr_redox	301	349	3e-6	PFAM
Pfam:DAO	301	557	9.9e-9	PFAM
Pfam:NAD_binding_8	304	368	4e-15	PFAM
Pfam:Amino_oxidase	309	847	2e-133	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000116273
AA Change: D558G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000111977
Gene: ENSMUSG00000036940
AA Change: D558G

Domain	Start	End	E-Value	Type
low complexity region	7	40	N/A	INTRINSIC
low complexity region	76	97	N/A	INTRINSIC
low complexity region	139	172	N/A	INTRINSIC
Pfam:SWIRM	175	265	2.7e-21	PFAM
Pfam:Pyr_redox	281	327	5.5e-7	PFAM
Pfam:FAD_binding_2	281	328	5.3e-6	PFAM
Pfam:DAO	281	403	3.7e-8	PFAM
Pfam:NAD_binding_8	284	348	5.7e-16	PFAM
Pfam:Amino_oxidase	289	827	9.6e-166	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125111

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139690

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147886

Predicted Effect

probably damaging
Transcript: ENSMUST00000155354
AA Change: D229G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114268
Gene: ENSMUSG00000036940
AA Change: D229G

Domain	Start	End	E-Value	Type
Pfam:Amino_oxidase	3	250	2.9e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000168936

Predicted Effect

probably benign
Transcript: ENSMUST00000170979

SMART Domains

Protein: ENSMUSP00000131385
Gene: ENSMUSG00000036940

Domain	Start	End	E-Value	Type
Pfam:SWIRM	1	77	2.5e-18	PFAM
Pfam:Pyr_redox_2	70	142	1.1e-7	PFAM
Pfam:AlaDh_PNT_C	85	195	7.8e-8	PFAM
Pfam:FAD_binding_2	93	140	1.7e-6	PFAM
Pfam:Pyr_redox	93	142	8.2e-7	PFAM
Pfam:DAO	93	319	2.8e-9	PFAM
Pfam:NAD_binding_8	96	160	9.8e-16	PFAM
Pfam:Amino_oxidase	101	313	5.1e-32	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171424

Meta Mutation Damage Score

0.4427

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous disruption of this gene results in abnormal gastrulation and early embryonic lethality. Homozygotes lacking the neurospecific isoform are hypoexcitable and display decreased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,686	I729V	probably damaging	Het
9530002B09Rik	A	T	4: 122,702,335	M120L	unknown	Het
Adamts13	T	A	2: 26,991,334	C774*	probably null	Het
Amh	A	G	10: 80,806,176		probably benign	Het
Ccdc173	C	A	2: 69,789,441	R8L	probably damaging	Het
Cd40	G	A	2: 165,070,741	R204Q	probably benign	Het
Clhc1	A	C	11: 29,561,366		probably benign	Het
Fbxl17	G	A	17: 63,356,851	R67C	probably damaging	Het
Flg2	A	T	3: 93,203,584	H973L	unknown	Het
Fut2	T	A	7: 45,651,274	I25F	probably damaging	Het
Galnt7	T	C	8: 57,552,430		probably benign	Het
Gm438	T	A	4: 144,777,415	I389L	possibly damaging	Het
Gm7534	T	C	4: 134,202,518	T159A	possibly damaging	Het
Gm8909	G	T	17: 36,168,057	P100Q	probably damaging	Het
Gmppb	A	T	9: 108,049,797	M56L	probably benign	Het
Grm3	C	A	5: 9,570,048	A399S	probably benign	Het
Hey2	G	A	10: 30,840,489		probably benign	Het
Ift172	A	G	5: 31,275,842		probably benign	Het
Kcnh5	C	A	12: 75,137,673	C92F	probably benign	Het
Klf11	C	G	12: 24,655,090	P164R	probably benign	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Krtcap3	T	C	5: 31,251,803	V6A	probably benign	Het
Ltbr	A	C	6: 125,313,388		probably null	Het
Mmp17	T	G	5: 129,598,670	S298A	probably benign	Het
Nacc2	T	A	2: 26,089,590	E278V	possibly damaging	Het
Olfr175-ps1	A	T	16: 58,824,155	Y185N	probably damaging	Het
Olfr875	T	A	9: 37,773,331	I224N	probably benign	Het
Otop2	C	T	11: 115,329,462	A376V	probably damaging	Het
Pdia2	T	C	17: 26,196,243	E504G	probably damaging	Het
Pdzph1	C	T	17: 58,922,727	V979M	probably damaging	Het
Pou5f1	A	G	17: 35,509,477	K86R	possibly damaging	Het
Ptprq	A	G	10: 107,710,627	F269L	probably benign	Het
Rb1	A	T	14: 73,211,712	C659*	probably null	Het
Rnf8	T	C	17: 29,621,639		probably null	Het
Rras	T	G	7: 45,020,556	I137M	probably benign	Het
Slc38a9	A	T	13: 112,714,198	H372L	probably damaging	Het
Spata9	T	C	13: 75,977,779		probably null	Het
Tas2r115	T	C	6: 132,737,959	T10A	probably benign	Het
Ttn	T	C	2: 76,798,893	E12621G	probably damaging	Het
Unc80	A	T	1: 66,506,669	I460F	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zbtb24	C	T	10: 41,451,997	A293V	possibly damaging	Het

Other mutations in Kdm1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00796:Kdm1a	APN	4	136554247	missense	probably damaging	1.00
IGL01106:Kdm1a	APN	4	136572328	splice site	probably benign
IGL01356:Kdm1a	APN	4	136553891	missense	probably damaging	1.00
IGL01886:Kdm1a	APN	4	136561016	critical splice donor site	probably null
IGL02605:Kdm1a	APN	4	136551037	unclassified	probably benign
IGL02885:Kdm1a	APN	4	136552535	missense	probably benign	0.00
Seven_falls	UTSW	4	136568600	nonsense	probably null
R0095:Kdm1a	UTSW	4	136550894	missense	probably benign	0.09
R0532:Kdm1a	UTSW	4	136561066	missense	probably damaging	1.00
R3625:Kdm1a	UTSW	4	136561108	missense	possibly damaging	0.93
R4085:Kdm1a	UTSW	4	136551962	nonsense	probably null
R4285:Kdm1a	UTSW	4	136582036	splice site	probably null
R5118:Kdm1a	UTSW	4	136557358	unclassified	probably benign
R5493:Kdm1a	UTSW	4	136557421	frame shift	probably null
R5800:Kdm1a	UTSW	4	136573070	splice site	probably null
R5945:Kdm1a	UTSW	4	136568701	splice site	probably null
R6256:Kdm1a	UTSW	4	136568600	nonsense	probably null
R6508:Kdm1a	UTSW	4	136554310	missense	probably damaging	1.00
R7243:Kdm1a	UTSW	4	136551954	missense	probably damaging	1.00
R7270:Kdm1a	UTSW	4	136552527	missense	probably damaging	0.97
R7723:Kdm1a	UTSW	4	136557749	missense	probably benign	0.06
R8391:Kdm1a	UTSW	4	136553843	missense	probably benign	0.45
R8698:Kdm1a	UTSW	4	136559207	missense	probably benign	0.00
R8840:Kdm1a	UTSW	4	136560405	missense	probably damaging	1.00
R9146:Kdm1a	UTSW	4	136602428	missense	unknown
R9778:Kdm1a	UTSW	4	136552581	missense	probably damaging	0.98
X0066:Kdm1a	UTSW	4	136559225	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCTACCTTCCTATAGAGCAGGCACG -3'
(R):5'- AGCAAGATCAGCCAGTGGTTCCTC -3'

Sequencing Primer
(F):5'- AGCAGGCACGTACCTGAG -3'
(R):5'- tccacccacccccactc -3'

Posted On

2013-06-11