Incidental Mutation 'R0553:Kdm1a'
ID 45275
Institutional Source Beutler Lab
Gene Symbol Kdm1a
Ensembl Gene ENSMUSG00000036940
Gene Name lysine (K)-specific demethylase 1A
Synonyms Aof2, 1810043O07Rik, Kdm1, LSD1
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 136550540-136602723 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 136555298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 229 (D229G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105847] [ENSMUST00000116273] [ENSMUST00000168936]
AlphaFold Q6ZQ88
Predicted Effect probably damaging
Transcript: ENSMUST00000046846
AA Change: D387G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035457
Gene: ENSMUSG00000036940
AA Change: D387G

DomainStartEndE-ValueType
low complexity region 47 80 N/A INTRINSIC
Pfam:SWIRM 85 173 1.1e-20 PFAM
Pfam:AlaDh_PNT_C 181 297 8.4e-8 PFAM
Pfam:FAD_binding_2 189 236 1.6e-6 PFAM
Pfam:Pyr_redox 189 237 6.5e-7 PFAM
Pfam:DAO 189 457 1.5e-9 PFAM
Pfam:NAD_binding_8 192 256 9e-16 PFAM
Pfam:Amino_oxidase 197 657 7e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105847
AA Change: D578G

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101473
Gene: ENSMUSG00000036940
AA Change: D578G

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
Pfam:SWIRM 197 285 8.8e-21 PFAM
Pfam:FAD_binding_2 301 348 6e-6 PFAM
Pfam:Pyr_redox 301 349 3e-6 PFAM
Pfam:DAO 301 557 9.9e-9 PFAM
Pfam:NAD_binding_8 304 368 4e-15 PFAM
Pfam:Amino_oxidase 309 847 2e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116273
AA Change: D558G

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000111977
Gene: ENSMUSG00000036940
AA Change: D558G

DomainStartEndE-ValueType
low complexity region 7 40 N/A INTRINSIC
low complexity region 76 97 N/A INTRINSIC
low complexity region 139 172 N/A INTRINSIC
Pfam:SWIRM 175 265 2.7e-21 PFAM
Pfam:Pyr_redox 281 327 5.5e-7 PFAM
Pfam:FAD_binding_2 281 328 5.3e-6 PFAM
Pfam:DAO 281 403 3.7e-8 PFAM
Pfam:NAD_binding_8 284 348 5.7e-16 PFAM
Pfam:Amino_oxidase 289 827 9.6e-166 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147886
Predicted Effect probably damaging
Transcript: ENSMUST00000155354
AA Change: D229G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114268
Gene: ENSMUSG00000036940
AA Change: D229G

DomainStartEndE-ValueType
Pfam:Amino_oxidase 3 250 2.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168936
Predicted Effect probably benign
Transcript: ENSMUST00000170979
SMART Domains Protein: ENSMUSP00000131385
Gene: ENSMUSG00000036940

DomainStartEndE-ValueType
Pfam:SWIRM 1 77 2.5e-18 PFAM
Pfam:Pyr_redox_2 70 142 1.1e-7 PFAM
Pfam:AlaDh_PNT_C 85 195 7.8e-8 PFAM
Pfam:FAD_binding_2 93 140 1.7e-6 PFAM
Pfam:Pyr_redox 93 142 8.2e-7 PFAM
Pfam:DAO 93 319 2.8e-9 PFAM
Pfam:NAD_binding_8 96 160 9.8e-16 PFAM
Pfam:Amino_oxidase 101 313 5.1e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171424
Meta Mutation Damage Score 0.4427 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein containing a SWIRM domain, a FAD-binding motif, and an amine oxidase domain. This protein is a component of several histone deacetylase complexes, though it silences genes by functioning as a histone demethylase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous disruption of this gene results in abnormal gastrulation and early embryonic lethality. Homozygotes lacking the neurospecific isoform are hypoexcitable and display decreased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Kdm1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Kdm1a APN 4 136554247 missense probably damaging 1.00
IGL01106:Kdm1a APN 4 136572328 splice site probably benign
IGL01356:Kdm1a APN 4 136553891 missense probably damaging 1.00
IGL01886:Kdm1a APN 4 136561016 critical splice donor site probably null
IGL02605:Kdm1a APN 4 136551037 unclassified probably benign
IGL02885:Kdm1a APN 4 136552535 missense probably benign 0.00
Seven_falls UTSW 4 136568600 nonsense probably null
R0095:Kdm1a UTSW 4 136550894 missense probably benign 0.09
R0532:Kdm1a UTSW 4 136561066 missense probably damaging 1.00
R3625:Kdm1a UTSW 4 136561108 missense possibly damaging 0.93
R4085:Kdm1a UTSW 4 136551962 nonsense probably null
R4285:Kdm1a UTSW 4 136582036 splice site probably null
R5118:Kdm1a UTSW 4 136557358 unclassified probably benign
R5493:Kdm1a UTSW 4 136557421 frame shift probably null
R5800:Kdm1a UTSW 4 136573070 splice site probably null
R5945:Kdm1a UTSW 4 136568701 splice site probably null
R6256:Kdm1a UTSW 4 136568600 nonsense probably null
R6508:Kdm1a UTSW 4 136554310 missense probably damaging 1.00
R7243:Kdm1a UTSW 4 136551954 missense probably damaging 1.00
R7270:Kdm1a UTSW 4 136552527 missense probably damaging 0.97
R7723:Kdm1a UTSW 4 136557749 missense probably benign 0.06
R8391:Kdm1a UTSW 4 136553843 missense probably benign 0.45
R8698:Kdm1a UTSW 4 136559207 missense probably benign 0.00
R8840:Kdm1a UTSW 4 136560405 missense probably damaging 1.00
R9146:Kdm1a UTSW 4 136602428 missense unknown
X0066:Kdm1a UTSW 4 136559225 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTACCTTCCTATAGAGCAGGCACG -3'
(R):5'- AGCAAGATCAGCCAGTGGTTCCTC -3'

Sequencing Primer
(F):5'- AGCAGGCACGTACCTGAG -3'
(R):5'- tccacccacccccactc -3'
Posted On 2013-06-11