Incidental Mutation 'R5731:Ugt2b5'
ID 452752
Institutional Source Beutler Lab
Gene Symbol Ugt2b5
Ensembl Gene ENSMUSG00000054630
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B5
Synonyms Udpgt-3, m-1
MMRRC Submission 043192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R5731 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 87124960-87140318 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 87140252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 19 (R19*)
Ref Sequence ENSEMBL: ENSMUSP00000068282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067790]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000067790
AA Change: R19*
SMART Domains Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: R19*

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 7.9e-256 PFAM
Pfam:Glyco_tran_28_C 352 449 5.3e-8 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,429,325 I58V unknown Het
Abca4 G T 3: 122,132,593 G18V probably damaging Het
Arl9 T C 5: 77,006,527 V34A possibly damaging Het
Bpifb9a A T 2: 154,262,243 N202I possibly damaging Het
C1qtnf6 A T 15: 78,527,314 M54K probably benign Het
Ccdc62 T C 5: 123,951,289 probably null Het
Cd177 A G 7: 24,744,421 C751R probably damaging Het
Clcn3 T C 8: 60,922,889 I657V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dag1 T C 9: 108,218,111 T61A probably benign Het
Fam184b C T 5: 45,553,129 G553E probably benign Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Flt1 T C 5: 147,678,152 H328R probably benign Het
Fmnl2 T A 2: 53,118,137 probably null Het
Gm5431 A G 11: 48,894,448 Y89H probably damaging Het
Gprin2 C A 14: 34,195,440 L124F probably damaging Het
Hacd2 T A 16: 35,102,004 Y188N probably damaging Het
Itgad A G 7: 128,198,554 T950A probably benign Het
Kit T A 5: 75,654,415 I933N possibly damaging Het
Klhl11 A T 11: 100,463,763 Y411N probably damaging Het
N4bp2 T C 5: 65,809,157 S1313P probably damaging Het
Neurog1 T C 13: 56,251,541 K131R probably damaging Het
Olfr1155 T A 2: 87,943,427 H67L possibly damaging Het
Olfr745 T C 14: 50,642,791 L170P probably damaging Het
Otogl T C 10: 107,881,464 D382G probably damaging Het
Pcdh1 A C 18: 38,198,598 F590V probably damaging Het
Pcdha5 G A 18: 36,960,767 V110M probably damaging Het
Pdlim3 A G 8: 45,915,247 N261D probably benign Het
Pou4f1 T C 14: 104,465,911 T362A unknown Het
Prlr A G 15: 10,314,135 T9A probably benign Het
Psmb7 T C 2: 38,588,277 Y245C probably damaging Het
Ryr3 T A 2: 112,641,572 D4515V probably damaging Het
Svop T C 5: 114,060,063 K149E probably damaging Het
Tlr3 A G 8: 45,398,120 V56A probably benign Het
Tm4sf20 T G 1: 82,760,292 I93L probably benign Het
Vmn2r28 G T 7: 5,488,669 T193K probably benign Het
Vps13c A G 9: 67,895,379 D654G probably damaging Het
Zfyve16 T A 13: 92,508,193 Q1167L probably benign Het
Other mutations in Ugt2b5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00702:Ugt2b5 APN 5 87125219 missense probably benign 0.02
IGL00742:Ugt2b5 APN 5 87127814 missense probably damaging 1.00
IGL01527:Ugt2b5 APN 5 87136209 missense possibly damaging 0.71
IGL01530:Ugt2b5 APN 5 87137245 missense probably benign 0.08
IGL01637:Ugt2b5 APN 5 87139900 missense probably benign 0.04
IGL02371:Ugt2b5 APN 5 87127676 critical splice donor site probably null
IGL02993:Ugt2b5 APN 5 87137232 missense probably damaging 1.00
IGL03114:Ugt2b5 APN 5 87128350 missense probably damaging 1.00
R0372:Ugt2b5 UTSW 5 87140258 missense probably benign 0.05
R0568:Ugt2b5 UTSW 5 87137365 critical splice acceptor site probably benign
R0650:Ugt2b5 UTSW 5 87139768 missense probably benign 0.00
R1660:Ugt2b5 UTSW 5 87139618 missense probably benign 0.00
R1907:Ugt2b5 UTSW 5 87139630 missense probably benign 0.19
R1955:Ugt2b5 UTSW 5 87127772 missense probably benign 0.18
R2389:Ugt2b5 UTSW 5 87127682 missense probably damaging 0.98
R2435:Ugt2b5 UTSW 5 87139606 missense probably damaging 0.99
R2919:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R2920:Ugt2b5 UTSW 5 87125407 missense possibly damaging 0.83
R4342:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4343:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4344:Ugt2b5 UTSW 5 87139723 missense probably damaging 1.00
R4355:Ugt2b5 UTSW 5 87139763 nonsense probably null
R4380:Ugt2b5 UTSW 5 87127894 missense probably damaging 1.00
R4789:Ugt2b5 UTSW 5 87139691 missense probably benign 0.14
R4993:Ugt2b5 UTSW 5 87139673 missense probably benign 0.00
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6035:Ugt2b5 UTSW 5 87139682 missense probably benign 0.09
R6491:Ugt2b5 UTSW 5 87125469 nonsense probably null
R7015:Ugt2b5 UTSW 5 87139796 missense probably damaging 1.00
R7203:Ugt2b5 UTSW 5 87128399 missense possibly damaging 0.72
R7212:Ugt2b5 UTSW 5 87125272 missense probably benign 0.06
R7750:Ugt2b5 UTSW 5 87140249 missense probably benign 0.11
R8384:Ugt2b5 UTSW 5 87140065 missense probably benign
R8465:Ugt2b5 UTSW 5 87139659 missense possibly damaging 0.79
R9336:Ugt2b5 UTSW 5 87137271 missense probably benign 0.00
X0004:Ugt2b5 UTSW 5 87128371 nonsense probably null
X0021:Ugt2b5 UTSW 5 87136211 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGTTTCAAACTTAAGGCCAGGTG -3'
(R):5'- AAGAGACATGGATCACTCTCATG -3'

Sequencing Primer
(F):5'- ACAGTGACTTCATGGCCT -3'
(R):5'- CATGGATCACTCTCATGTAAAAAGGG -3'
Posted On 2017-01-03