Incidental Mutation 'R5731:Cd177'
ID452758
Institutional Source Beutler Lab
Gene Symbol Cd177
Ensembl Gene ENSMUSG00000052212
Gene NameCD177 antigen
SynonymsPdp3, 1190003K14Rik
MMRRC Submission 043192-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R5731 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24743983-24760311 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24744421 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 751 (C751R)
Ref Sequence ENSEMBL: ENSMUSP00000064934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063956]
Predicted Effect probably damaging
Transcript: ENSMUST00000063956
AA Change: C751R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: C751R

DomainStartEndE-ValueType
Pfam:UPAR_LY6 134 214 3.7e-11 PFAM
Pfam:UPAR_LY6 226 300 1.2e-4 PFAM
low complexity region 301 317 N/A INTRINSIC
Pfam:UPAR_LY6 322 400 1.5e-9 PFAM
Pfam:UPAR_LY6 511 586 9.1e-12 PFAM
Pfam:UPAR_LY6 705 782 1.4e-11 PFAM
low complexity region 795 811 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206160
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,429,325 I58V unknown Het
Abca4 G T 3: 122,132,593 G18V probably damaging Het
Arl9 T C 5: 77,006,527 V34A possibly damaging Het
Bpifb9a A T 2: 154,262,243 N202I possibly damaging Het
C1qtnf6 A T 15: 78,527,314 M54K probably benign Het
Ccdc62 T C 5: 123,951,289 probably null Het
Clcn3 T C 8: 60,922,889 I657V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dag1 T C 9: 108,218,111 T61A probably benign Het
Fam184b C T 5: 45,553,129 G553E probably benign Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Flt1 T C 5: 147,678,152 H328R probably benign Het
Fmnl2 T A 2: 53,118,137 probably null Het
Gm5431 A G 11: 48,894,448 Y89H probably damaging Het
Gprin2 C A 14: 34,195,440 L124F probably damaging Het
Hacd2 T A 16: 35,102,004 Y188N probably damaging Het
Itgad A G 7: 128,198,554 T950A probably benign Het
Kit T A 5: 75,654,415 I933N possibly damaging Het
Klhl11 A T 11: 100,463,763 Y411N probably damaging Het
N4bp2 T C 5: 65,809,157 S1313P probably damaging Het
Neurog1 T C 13: 56,251,541 K131R probably damaging Het
Olfr1155 T A 2: 87,943,427 H67L possibly damaging Het
Olfr745 T C 14: 50,642,791 L170P probably damaging Het
Otogl T C 10: 107,881,464 D382G probably damaging Het
Pcdh1 A C 18: 38,198,598 F590V probably damaging Het
Pcdha5 G A 18: 36,960,767 V110M probably damaging Het
Pdlim3 A G 8: 45,915,247 N261D probably benign Het
Pou4f1 T C 14: 104,465,911 T362A unknown Het
Prlr A G 15: 10,314,135 T9A probably benign Het
Psmb7 T C 2: 38,588,277 Y245C probably damaging Het
Ryr3 T A 2: 112,641,572 D4515V probably damaging Het
Svop T C 5: 114,060,063 K149E probably damaging Het
Tlr3 A G 8: 45,398,120 V56A probably benign Het
Tm4sf20 T G 1: 82,760,292 I93L probably benign Het
Ugt2b5 T A 5: 87,140,252 R19* probably null Het
Vmn2r28 G T 7: 5,488,669 T193K probably benign Het
Vps13c A G 9: 67,895,379 D654G probably damaging Het
Zfyve16 T A 13: 92,508,193 Q1167L probably benign Het
Other mutations in Cd177
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cd177 APN 7 24759751 missense possibly damaging 0.59
IGL00479:Cd177 APN 7 24758015 missense probably benign 0.05
IGL00673:Cd177 APN 7 24752017 missense possibly damaging 0.78
IGL00913:Cd177 APN 7 24756195 missense probably damaging 1.00
IGL01445:Cd177 APN 7 24752071 missense possibly damaging 0.95
IGL02021:Cd177 APN 7 24745206 missense probably benign 0.16
IGL02134:Cd177 APN 7 24752352 missense probably benign 0.01
IGL02532:Cd177 APN 7 24745249 missense probably benign 0.30
IGL02821:Cd177 APN 7 24744393 missense probably damaging 1.00
IGL02821:Cd177 APN 7 24744394 missense probably damaging 1.00
IGL02888:Cd177 APN 7 24758437 missense probably damaging 0.99
R0506:Cd177 UTSW 7 24758356 missense probably damaging 1.00
R0601:Cd177 UTSW 7 24752313 missense probably benign 0.00
R0631:Cd177 UTSW 7 24756686 missense probably benign 0.03
R0713:Cd177 UTSW 7 24744430 missense probably benign 0.25
R1595:Cd177 UTSW 7 24744964 missense probably benign
R1659:Cd177 UTSW 7 24746137 missense probably damaging 1.00
R2258:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2260:Cd177 UTSW 7 24756236 missense possibly damaging 0.73
R2379:Cd177 UTSW 7 24758043 missense possibly damaging 0.80
R2763:Cd177 UTSW 7 24758037 missense probably benign 0.05
R2929:Cd177 UTSW 7 24754279 nonsense probably null
R3815:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3818:Cd177 UTSW 7 24754392 missense probably benign 0.00
R3919:Cd177 UTSW 7 24744433 missense probably benign 0.15
R4300:Cd177 UTSW 7 24750420 missense possibly damaging 0.48
R4494:Cd177 UTSW 7 24752003 missense probably benign 0.06
R4781:Cd177 UTSW 7 24750626 missense probably damaging 1.00
R4819:Cd177 UTSW 7 24752271 missense probably damaging 1.00
R5062:Cd177 UTSW 7 24744316 missense probably benign 0.03
R5186:Cd177 UTSW 7 24744923 missense probably benign 0.31
R5285:Cd177 UTSW 7 24746249 missense probably benign 0.00
R5415:Cd177 UTSW 7 24752391 missense probably damaging 1.00
R5577:Cd177 UTSW 7 24745137 missense probably damaging 1.00
R5637:Cd177 UTSW 7 24756323 missense probably benign 0.01
R5673:Cd177 UTSW 7 24750362 missense probably damaging 1.00
R5775:Cd177 UTSW 7 24752268 missense probably damaging 1.00
R5840:Cd177 UTSW 7 24758070 missense probably damaging 0.99
R5870:Cd177 UTSW 7 24756332 missense probably benign 0.00
R5872:Cd177 UTSW 7 24752263 missense probably null 1.00
R6148:Cd177 UTSW 7 24744273 nonsense probably null
R6505:Cd177 UTSW 7 24744246 missense probably benign 0.00
R6897:Cd177 UTSW 7 24745074 missense probably benign 0.31
R7023:Cd177 UTSW 7 24759762 missense probably benign 0.44
R7088:Cd177 UTSW 7 24745133 nonsense probably null
R7188:Cd177 UTSW 7 24756647 missense probably damaging 1.00
R7366:Cd177 UTSW 7 24756722 missense probably damaging 1.00
R7744:Cd177 UTSW 7 24750375 missense probably damaging 1.00
R8008:Cd177 UTSW 7 24752349 missense not run
R8029:Cd177 UTSW 7 24756169 nonsense probably null
R8030:Cd177 UTSW 7 24756169 nonsense probably null
R8032:Cd177 UTSW 7 24756169 nonsense probably null
Z1176:Cd177 UTSW 7 24746171 missense probably benign 0.01
Z1177:Cd177 UTSW 7 24760256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCAGCATACAAAGAGCTGAG -3'
(R):5'- TCTCAGATGGAAGAGGCCTG -3'

Sequencing Primer
(F):5'- CTGAGAAGAGCCGATAGCCC -3'
(R):5'- TACTGGACACCTGGGTCTGAG -3'
Posted On2017-01-03