Incidental Mutation 'R0553:Gm438'
ID45276
Institutional Source Beutler Lab
Gene Symbol Gm438
Ensembl Gene ENSMUSG00000078504
Gene Namepredicted gene 438
SynonymsLOC329993
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0553 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location144777204-144786583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 144777415 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 389 (I389L)
Ref Sequence ENSEMBL: ENSMUSP00000101372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105746]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105746
AA Change: I389L

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101372
Gene: ENSMUSG00000078504
AA Change: I389L

DomainStartEndE-ValueType
transmembrane domain 3 25 N/A INTRINSIC
Pfam:Abhydrolase_3 111 270 4.9e-22 PFAM
Pfam:Abhydrolase_3 284 366 1.3e-11 PFAM
Meta Mutation Damage Score 0.1697 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Gm438
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Gm438 APN 4 144777689 nonsense probably null
IGL01293:Gm438 APN 4 144777589 missense probably benign 0.00
IGL01678:Gm438 APN 4 144777873 missense probably benign 0.20
IGL02609:Gm438 APN 4 144779737 missense probably damaging 1.00
IGL02684:Gm438 APN 4 144778185 splice site probably benign
IGL02734:Gm438 APN 4 144779779 missense probably damaging 1.00
IGL02869:Gm438 APN 4 144786368 missense probably benign 0.01
IGL02988:Gm438 APN 4 144786530 utr 5 prime probably benign
R1514:Gm438 UTSW 4 144777759 missense probably damaging 1.00
R1856:Gm438 UTSW 4 144777883 missense probably benign
R1957:Gm438 UTSW 4 144777819 missense possibly damaging 0.94
R2014:Gm438 UTSW 4 144779725 missense probably damaging 1.00
R2243:Gm438 UTSW 4 144777421 missense probably benign
R4943:Gm438 UTSW 4 144777720 missense probably benign 0.07
R5439:Gm438 UTSW 4 144778113 missense probably damaging 1.00
R5520:Gm438 UTSW 4 144778024 missense probably benign 0.00
R6414:Gm438 UTSW 4 144777415 missense possibly damaging 0.57
R6664:Gm438 UTSW 4 144777399 makesense probably null
R6869:Gm438 UTSW 4 144780472 critical splice donor site probably null
R7384:Gm438 UTSW 4 144780621 missense possibly damaging 0.89
R7439:Gm438 UTSW 4 144777762 missense probably damaging 1.00
R7484:Gm438 UTSW 4 144777951 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGTTCTCTGCTTCCACATCTAATTCCAACAT -3'
(R):5'- TCTGCACTTCATCAATTTTCAGTTACCATCAT -3'

Sequencing Primer
(F):5'- AACATGCGTCATGGATGTCTTC -3'
(R):5'- TGGACAGATGCCATGTCTAC -3'
Posted On2013-06-11