Incidental Mutation 'R5731:Tlr3'
ID452762
Institutional Source Beutler Lab
Gene Symbol Tlr3
Ensembl Gene ENSMUSG00000031639
Gene Nametoll-like receptor 3
Synonyms
MMRRC Submission 043192-MU
Accession Numbers

Ncbi RefSeq: NM_126166; MGI: 2156367

Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5731 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location45395665-45411080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45398120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 56 (V56A)
Ref Sequence ENSEMBL: ENSMUSP00000147783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034056] [ENSMUST00000167106] [ENSMUST00000209651] [ENSMUST00000209772] [ENSMUST00000210013] [ENSMUST00000210996] [ENSMUST00000211370]
Predicted Effect probably benign
Transcript: ENSMUST00000034056
AA Change: V580A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034056
Gene: ENSMUSG00000031639
AA Change: V580A

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167106
AA Change: V580A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126556
Gene: ENSMUSG00000031639
AA Change: V580A

DomainStartEndE-ValueType
LRRNT 28 56 1.14e1 SMART
LRR 50 74 1.33e1 SMART
LRR_TYP 99 122 4.72e-2 SMART
LRR 123 146 2.47e2 SMART
LRR 171 194 3.36e1 SMART
LRR 198 220 7.57e0 SMART
low complexity region 224 238 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
LRR 274 297 1.06e1 SMART
LRR_TYP 298 321 1.28e-3 SMART
LRR 355 378 6.23e1 SMART
LRR 379 404 3.18e2 SMART
LRR 405 430 8.98e1 SMART
LRR 431 455 6.78e1 SMART
LRR_TYP 506 529 1.79e-2 SMART
LRR 530 553 2.63e0 SMART
LRR_TYP 562 585 1.56e-2 SMART
LRR 586 609 1.37e1 SMART
LRR 611 633 8.48e0 SMART
LRRCT 646 698 1.07e-10 SMART
transmembrane domain 705 724 N/A INTRINSIC
TIR 756 901 2.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209651
Predicted Effect probably benign
Transcript: ENSMUST00000209772
AA Change: V580A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000210013
AA Change: V56A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000210996
Predicted Effect probably benign
Transcript: ENSMUST00000211370
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show alterations in innate immunity against different viruses, viral pathogenesis, anxiety, hippocampal synaptic plasticity, memory retention and neurogenesis. Homozygotes for another null allele show altered ds-RNA responses in dendritic and aorta smooth muscle cells. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,429,325 I58V unknown Het
Abca4 G T 3: 122,132,593 G18V probably damaging Het
Arl9 T C 5: 77,006,527 V34A possibly damaging Het
Bpifb9a A T 2: 154,262,243 N202I possibly damaging Het
C1qtnf6 A T 15: 78,527,314 M54K probably benign Het
Ccdc62 T C 5: 123,951,289 probably null Het
Cd177 A G 7: 24,744,421 C751R probably damaging Het
Clcn3 T C 8: 60,922,889 I657V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dag1 T C 9: 108,218,111 T61A probably benign Het
Fam184b C T 5: 45,553,129 G553E probably benign Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Flt1 T C 5: 147,678,152 H328R probably benign Het
Fmnl2 T A 2: 53,118,137 probably null Het
Gm5431 A G 11: 48,894,448 Y89H probably damaging Het
Gprin2 C A 14: 34,195,440 L124F probably damaging Het
Hacd2 T A 16: 35,102,004 Y188N probably damaging Het
Itgad A G 7: 128,198,554 T950A probably benign Het
Kit T A 5: 75,654,415 I933N possibly damaging Het
Klhl11 A T 11: 100,463,763 Y411N probably damaging Het
N4bp2 T C 5: 65,809,157 S1313P probably damaging Het
Neurog1 T C 13: 56,251,541 K131R probably damaging Het
Olfr1155 T A 2: 87,943,427 H67L possibly damaging Het
Olfr745 T C 14: 50,642,791 L170P probably damaging Het
Otogl T C 10: 107,881,464 D382G probably damaging Het
Pcdh1 A C 18: 38,198,598 F590V probably damaging Het
Pcdha5 G A 18: 36,960,767 V110M probably damaging Het
Pdlim3 A G 8: 45,915,247 N261D probably benign Het
Pou4f1 T C 14: 104,465,911 T362A unknown Het
Prlr A G 15: 10,314,135 T9A probably benign Het
Psmb7 T C 2: 38,588,277 Y245C probably damaging Het
Ryr3 T A 2: 112,641,572 D4515V probably damaging Het
Svop T C 5: 114,060,063 K149E probably damaging Het
Tm4sf20 T G 1: 82,760,292 I93L probably benign Het
Ugt2b5 T A 5: 87,140,252 R19* probably null Het
Vmn2r28 G T 7: 5,488,669 T193K probably benign Het
Vps13c A G 9: 67,895,379 D654G probably damaging Het
Zfyve16 T A 13: 92,508,193 Q1167L probably benign Het
Other mutations in Tlr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tlr3 APN 8 45400690 missense probably damaging 0.99
IGL01820:Tlr3 APN 8 45398339 missense probably benign
IGL02504:Tlr3 APN 8 45397907 missense probably damaging 1.00
IGL02523:Tlr3 APN 8 45398391 unclassified probably null
IGL03166:Tlr3 APN 8 45402928 missense probably benign 0.05
IGL03287:Tlr3 APN 8 45402780 missense probably benign
Rakshasa UTSW 8 45397697 missense probably benign 0.08
Ultraman UTSW 8 45402981 missense probably damaging 1.00
E0354:Tlr3 UTSW 8 45400820 missense probably damaging 1.00
R0960:Tlr3 UTSW 8 45397415 missense probably damaging 1.00
R1175:Tlr3 UTSW 8 45397134 missense probably damaging 1.00
R1332:Tlr3 UTSW 8 45398737 missense probably damaging 0.99
R1477:Tlr3 UTSW 8 45398165 missense probably damaging 1.00
R1667:Tlr3 UTSW 8 45400837 missense probably benign 0.00
R1755:Tlr3 UTSW 8 45397973 missense probably benign
R1996:Tlr3 UTSW 8 45397697 missense probably benign 0.08
R2012:Tlr3 UTSW 8 45402786 missense possibly damaging 0.91
R2288:Tlr3 UTSW 8 45397668 missense probably damaging 0.98
R2895:Tlr3 UTSW 8 45397592 missense possibly damaging 0.89
R3837:Tlr3 UTSW 8 45396939 missense probably damaging 1.00
R4905:Tlr3 UTSW 8 45399223 critical splice acceptor site probably null
R4934:Tlr3 UTSW 8 45397035 missense probably benign 0.10
R5025:Tlr3 UTSW 8 45403038 missense probably benign 0.00
R5086:Tlr3 UTSW 8 45402825 missense probably damaging 0.96
R5129:Tlr3 UTSW 8 45402981 missense probably damaging 1.00
R5320:Tlr3 UTSW 8 45399100 missense possibly damaging 0.95
R5411:Tlr3 UTSW 8 45396955 missense probably benign 0.01
R5497:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5498:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5499:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5501:Tlr3 UTSW 8 45398814 missense possibly damaging 0.60
R5761:Tlr3 UTSW 8 45402771 missense probably benign 0.00
R5992:Tlr3 UTSW 8 45397814 missense probably benign
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6031:Tlr3 UTSW 8 45398528 missense probably damaging 1.00
R6104:Tlr3 UTSW 8 45403093 missense probably benign 0.00
R6289:Tlr3 UTSW 8 45396929 missense probably benign 0.04
R6372:Tlr3 UTSW 8 45397011 missense probably damaging 1.00
R6470:Tlr3 UTSW 8 45397385 missense probably damaging 1.00
R6486:Tlr3 UTSW 8 45398613 unclassified probably null
R6504:Tlr3 UTSW 8 45397449 missense possibly damaging 0.79
R6721:Tlr3 UTSW 8 45398880 missense probably benign 0.00
R7089:Tlr3 UTSW 8 45397773 missense probably benign 0.02
R7169:Tlr3 UTSW 8 45397019 missense probably damaging 1.00
R7679:Tlr3 UTSW 8 45399051 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGGTTTTGAAAAGGCGGC -3'
(R):5'- TTCGTAACTTGACCATTCTGGAC -3'

Sequencing Primer
(F):5'- TTTGAAAAGGCGGCCCGAAAAC -3'
(R):5'- CTTGACCATTCTGGACTTAAGCAAC -3'
Posted On2017-01-03