Incidental Mutation 'R0553:Grm3'
ID 45277
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Name glutamate receptor, metabotropic 3
Synonyms Gprc1c, mGlu3, mGluR3, 0710001G23Rik
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 9485541-9725170 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 9570048 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 399 (A399S)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
AlphaFold Q9QYS2
Predicted Effect probably benign
Transcript: ENSMUST00000004076
AA Change: A399S

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: A399S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Meta Mutation Damage Score 0.5099 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9512290 missense probably benign
IGL01393:Grm3 APN 5 9589856 missense probably benign 0.00
IGL01398:Grm3 APN 5 9485762 unclassified probably benign
IGL01825:Grm3 APN 5 9511600 missense probably damaging 1.00
IGL01966:Grm3 APN 5 9511486 missense probably damaging 0.98
IGL02367:Grm3 APN 5 9511660 missense probably damaging 1.00
IGL02526:Grm3 APN 5 9589847 missense probably damaging 1.00
IGL02972:Grm3 APN 5 9512410 missense probably damaging 1.00
IGL03356:Grm3 APN 5 9512206 missense possibly damaging 0.89
BB002:Grm3 UTSW 5 9589880 missense probably benign 0.09
BB012:Grm3 UTSW 5 9589880 missense probably benign 0.09
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0389:Grm3 UTSW 5 9504794 missense probably damaging 1.00
R0455:Grm3 UTSW 5 9512477 missense probably benign
R0538:Grm3 UTSW 5 9512446 missense possibly damaging 0.95
R1124:Grm3 UTSW 5 9570297 missense probably benign
R1163:Grm3 UTSW 5 9570738 missense probably benign 0.34
R1440:Grm3 UTSW 5 9589958 missense probably benign
R1635:Grm3 UTSW 5 9511520 missense probably damaging 1.00
R1734:Grm3 UTSW 5 9589742 missense probably benign 0.00
R1895:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R1926:Grm3 UTSW 5 9504881 missense probably damaging 0.98
R1940:Grm3 UTSW 5 9511682 missense probably damaging 1.00
R1946:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R2004:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R3116:Grm3 UTSW 5 9570752 missense probably damaging 1.00
R4083:Grm3 UTSW 5 9512054 missense probably benign
R4537:Grm3 UTSW 5 9512083 missense probably benign 0.02
R4855:Grm3 UTSW 5 9570047 missense probably damaging 0.98
R5060:Grm3 UTSW 5 9570167 missense probably damaging 0.99
R5093:Grm3 UTSW 5 9589766 missense probably benign 0.01
R5419:Grm3 UTSW 5 9570233 missense probably damaging 1.00
R5525:Grm3 UTSW 5 9504872 missense probably damaging 1.00
R5642:Grm3 UTSW 5 9570536 missense probably benign 0.21
R5804:Grm3 UTSW 5 9570155 missense probably benign 0.33
R5915:Grm3 UTSW 5 9511927 missense probably damaging 1.00
R5966:Grm3 UTSW 5 9511930 missense probably damaging 0.98
R6151:Grm3 UTSW 5 9511556 missense probably damaging 1.00
R6419:Grm3 UTSW 5 9570201 missense probably damaging 1.00
R7267:Grm3 UTSW 5 9589581 missense probably benign 0.00
R7555:Grm3 UTSW 5 9570000 missense probably benign 0.00
R7657:Grm3 UTSW 5 9511452 splice site probably null
R7925:Grm3 UTSW 5 9589880 missense probably benign 0.09
R8032:Grm3 UTSW 5 9512272 missense probably benign 0.11
R8227:Grm3 UTSW 5 9570242 missense possibly damaging 0.65
R8462:Grm3 UTSW 5 9512365 missense probably benign
R8500:Grm3 UTSW 5 9511726 missense probably benign 0.21
R8696:Grm3 UTSW 5 9512311 missense probably damaging 1.00
R8807:Grm3 UTSW 5 9511499 missense probably damaging 1.00
R8828:Grm3 UTSW 5 9504725 missense probably benign 0.00
R8876:Grm3 UTSW 5 9511580 missense probably damaging 1.00
R8896:Grm3 UTSW 5 9512483 missense possibly damaging 0.91
R9035:Grm3 UTSW 5 9570464 missense probably damaging 0.99
X0020:Grm3 UTSW 5 9512195 missense probably damaging 1.00
X0025:Grm3 UTSW 5 9485790 missense probably damaging 1.00
X0026:Grm3 UTSW 5 9512238 nonsense probably null
Z1088:Grm3 UTSW 5 9570183 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACAAAGGCCCACTGCTTACCTG -3'
(R):5'- GATGACTCACGAGAGTTGATCGCTG -3'

Sequencing Primer
(F):5'- CACTGCTTACCTGTGAAGTTG -3'
(R):5'- AGTTTGATCGCTACTTCCAGAG -3'
Posted On 2013-06-11