Incidental Mutation 'R5731:Klhl11'
ID452773
Institutional Source Beutler Lab
Gene Symbol Klhl11
Ensembl Gene ENSMUSG00000048732
Gene Namekelch-like 11
Synonyms
MMRRC Submission 043192-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R5731 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100462614-100472741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100463763 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 411 (Y411N)
Ref Sequence ENSEMBL: ENSMUSP00000054963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056665]
Predicted Effect probably damaging
Transcript: ENSMUST00000056665
AA Change: Y411N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054963
Gene: ENSMUSG00000048732
AA Change: Y411N

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
BTB 95 201 2.69e-21 SMART
BACK 206 308 9.54e-26 SMART
Kelch 361 408 4.1e0 SMART
Kelch 409 454 2.61e-1 SMART
Kelch 455 502 2.17e-1 SMART
Kelch 611 662 1.39e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5930422O12Rik A G 8: 33,429,325 I58V unknown Het
Abca4 G T 3: 122,132,593 G18V probably damaging Het
Arl9 T C 5: 77,006,527 V34A possibly damaging Het
Bpifb9a A T 2: 154,262,243 N202I possibly damaging Het
C1qtnf6 A T 15: 78,527,314 M54K probably benign Het
Ccdc62 T C 5: 123,951,289 probably null Het
Cd177 A G 7: 24,744,421 C751R probably damaging Het
Clcn3 T C 8: 60,922,889 I657V possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Dag1 T C 9: 108,218,111 T61A probably benign Het
Fam184b C T 5: 45,553,129 G553E probably benign Het
Fkbp15 G C 4: 62,306,929 A831G probably benign Het
Flt1 T C 5: 147,678,152 H328R probably benign Het
Fmnl2 T A 2: 53,118,137 probably null Het
Gm5431 A G 11: 48,894,448 Y89H probably damaging Het
Gprin2 C A 14: 34,195,440 L124F probably damaging Het
Hacd2 T A 16: 35,102,004 Y188N probably damaging Het
Itgad A G 7: 128,198,554 T950A probably benign Het
Kit T A 5: 75,654,415 I933N possibly damaging Het
N4bp2 T C 5: 65,809,157 S1313P probably damaging Het
Neurog1 T C 13: 56,251,541 K131R probably damaging Het
Olfr1155 T A 2: 87,943,427 H67L possibly damaging Het
Olfr745 T C 14: 50,642,791 L170P probably damaging Het
Otogl T C 10: 107,881,464 D382G probably damaging Het
Pcdh1 A C 18: 38,198,598 F590V probably damaging Het
Pcdha5 G A 18: 36,960,767 V110M probably damaging Het
Pdlim3 A G 8: 45,915,247 N261D probably benign Het
Pou4f1 T C 14: 104,465,911 T362A unknown Het
Prlr A G 15: 10,314,135 T9A probably benign Het
Psmb7 T C 2: 38,588,277 Y245C probably damaging Het
Ryr3 T A 2: 112,641,572 D4515V probably damaging Het
Svop T C 5: 114,060,063 K149E probably damaging Het
Tlr3 A G 8: 45,398,120 V56A probably benign Het
Tm4sf20 T G 1: 82,760,292 I93L probably benign Het
Ugt2b5 T A 5: 87,140,252 R19* probably null Het
Vmn2r28 G T 7: 5,488,669 T193K probably benign Het
Vps13c A G 9: 67,895,379 D654G probably damaging Het
Zfyve16 T A 13: 92,508,193 Q1167L probably benign Het
Other mutations in Klhl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Klhl11 APN 11 100463205 missense possibly damaging 0.94
IGL02334:Klhl11 APN 11 100463836 missense probably damaging 1.00
IGL02886:Klhl11 APN 11 100472221 missense possibly damaging 0.92
R0372:Klhl11 UTSW 11 100463522 missense probably damaging 0.97
R0583:Klhl11 UTSW 11 100464324 missense possibly damaging 0.57
R0608:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R0609:Klhl11 UTSW 11 100463714 missense probably damaging 1.00
R1417:Klhl11 UTSW 11 100472289 missense probably benign 0.00
R1629:Klhl11 UTSW 11 100464186 missense probably benign 0.00
R1643:Klhl11 UTSW 11 100463015 missense probably benign 0.09
R1985:Klhl11 UTSW 11 100463244 missense probably benign 0.00
R3844:Klhl11 UTSW 11 100472307 missense possibly damaging 0.84
R4746:Klhl11 UTSW 11 100464350 missense probably benign 0.00
R5053:Klhl11 UTSW 11 100472200 missense probably damaging 1.00
R5426:Klhl11 UTSW 11 100464116 missense probably damaging 1.00
R5755:Klhl11 UTSW 11 100464351 missense probably benign 0.00
R6874:Klhl11 UTSW 11 100472205 missense probably benign 0.00
R7295:Klhl11 UTSW 11 100472242 missense probably damaging 1.00
R7426:Klhl11 UTSW 11 100464352 missense probably benign 0.17
R7554:Klhl11 UTSW 11 100463948 missense probably benign
R8125:Klhl11 UTSW 11 100463985 missense probably benign
R8145:Klhl11 UTSW 11 100463914 missense probably damaging 0.99
Z1177:Klhl11 UTSW 11 100463966 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCCATTTATCAAGCTCGGG -3'
(R):5'- TCACTGTTACCTCGCTATGGAC -3'

Sequencing Primer
(F):5'- TCACGTCTTTAAAGCCAGGG -3'
(R):5'- GTTACCTCGCTATGGACAAAACATGG -3'
Posted On2017-01-03