Incidental Mutation 'R5135:Cyp4a14'
ID 452786
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission 043261-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5135 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 115347157 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably null
Transcript: ENSMUST00000030487
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.9475 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik T C 1: 183,765,703 (GRCm39) S119G probably benign Het
4930553M12Rik G T 4: 88,786,508 (GRCm39) H37N unknown Het
Adam10 T A 9: 70,673,356 (GRCm39) C496S probably damaging Het
Aldh18a1 A C 19: 40,543,261 (GRCm39) probably benign Het
Alox5 A G 6: 116,390,747 (GRCm39) F468S probably benign Het
Ankrd50 T C 3: 38,509,952 (GRCm39) H805R probably damaging Het
Ap2s1 T A 7: 16,481,248 (GRCm39) D72E probably damaging Het
Apaf1 T C 10: 90,895,956 (GRCm39) Y372C probably damaging Het
Apob C T 12: 8,060,086 (GRCm39) T2823I probably damaging Het
Bhmt A G 13: 93,763,831 (GRCm39) V70A probably damaging Het
Bltp3b T C 10: 89,625,217 (GRCm39) I48T probably damaging Het
Cdc42bpg T A 19: 6,370,648 (GRCm39) L1247H probably damaging Het
Cel A G 2: 28,449,435 (GRCm39) V264A probably benign Het
Celsr2 T C 3: 108,305,975 (GRCm39) N2043S probably damaging Het
Clca4a A T 3: 144,660,707 (GRCm39) W706R probably damaging Het
Col22a1 G T 15: 71,671,186 (GRCm39) P1058Q unknown Het
Dhx30 T G 9: 109,927,863 (GRCm39) R55S probably damaging Het
Dlgap5 C T 14: 47,637,122 (GRCm39) R452H probably damaging Het
Dnah12 T A 14: 26,492,434 (GRCm39) D1191E probably damaging Het
Dock3 A T 9: 106,810,196 (GRCm39) I164N probably damaging Het
Edrf1 T A 7: 133,252,773 (GRCm39) M436K probably benign Het
Eif2ak2 T A 17: 79,173,774 (GRCm39) Y268F probably damaging Het
Evi2a G A 11: 79,418,277 (GRCm39) T111M possibly damaging Het
Fzd4 A G 7: 89,056,709 (GRCm39) E252G probably damaging Het
Gcm2 A G 13: 41,256,435 (GRCm39) V438A probably benign Het
Gm10722 T C 9: 3,000,937 (GRCm39) C6R probably benign Het
Gm4787 G C 12: 81,424,604 (GRCm39) T518S probably benign Het
Gm4846 T C 1: 166,311,551 (GRCm39) D436G probably damaging Het
Gm5414 T A 15: 101,536,203 (GRCm39) I141F probably damaging Het
Gm6185 T A 1: 161,025,801 (GRCm39) noncoding transcript Het
Grip2 T C 6: 91,750,897 (GRCm39) E776G possibly damaging Het
H2-Ob T A 17: 34,462,490 (GRCm39) V160E probably benign Het
Hormad1 T C 3: 95,492,531 (GRCm39) probably benign Het
Ighv2-1 A T 12: 113,538,082 (GRCm39) probably benign Het
Igkv4-92 A T 6: 68,732,538 (GRCm39) C14S probably benign Het
Iqsec3 T C 6: 121,360,878 (GRCm39) I993M probably damaging Het
Kdm5b T A 1: 134,516,484 (GRCm39) probably benign Het
Kitl T C 10: 99,924,084 (GRCm39) probably null Het
Klhl26 G T 8: 70,905,368 (GRCm39) R100S probably benign Het
Kpna4 C T 3: 69,000,142 (GRCm39) probably null Het
Lama5 T A 2: 179,844,013 (GRCm39) N383Y possibly damaging Het
Large1 T G 8: 73,544,724 (GRCm39) I685L probably benign Het
Larp4b A G 13: 9,220,773 (GRCm39) E590G probably damaging Het
Liph A T 16: 21,774,915 (GRCm39) C425* probably null Het
Lrrc31 A T 3: 30,739,039 (GRCm39) C327* probably null Het
Lrrc36 T C 8: 106,190,530 (GRCm39) V733A probably benign Het
Mmel1 T A 4: 154,966,781 (GRCm39) I83K probably benign Het
Myo16 G T 8: 10,526,114 (GRCm39) V885L probably benign Het
Naip2 A T 13: 100,315,948 (GRCm39) N277K probably damaging Het
Ncapg2 T A 12: 116,391,406 (GRCm39) I485N possibly damaging Het
Npc1l1 A T 11: 6,174,245 (GRCm39) Y687N possibly damaging Het
Obscn A T 11: 59,020,479 (GRCm39) V922E probably damaging Het
Oc90 A G 15: 65,755,679 (GRCm39) S223P probably benign Het
Or1e16 AGCGGTCGTAGGC AGC 11: 73,286,480 (GRCm39) probably null Het
Or4a80 A T 2: 89,582,239 (GRCm39) L311H possibly damaging Het
Or4e1 T C 14: 52,701,311 (GRCm39) I52V probably benign Het
Pakap G T 4: 57,855,912 (GRCm39) A414S probably benign Het
Pdlim5 C T 3: 142,010,126 (GRCm39) R174H probably benign Het
Pex5l G T 3: 33,009,980 (GRCm39) A386E probably damaging Het
Plcxd1 T A 5: 110,249,229 (GRCm39) probably benign Het
Pramel12 T G 4: 143,145,579 (GRCm39) S349R probably benign Het
Prl8a1 A T 13: 27,763,802 (GRCm39) probably null Het
Ryr2 G T 13: 11,677,016 (GRCm39) N3278K probably benign Het
Sacm1l A G 9: 123,406,090 (GRCm39) M324V probably benign Het
Sdad1 T C 5: 92,451,793 (GRCm39) T143A probably benign Het
Sec11a A T 7: 80,572,812 (GRCm39) probably benign Het
Sema6a A G 18: 47,424,239 (GRCm39) V223A probably damaging Het
Serpinb6c A G 13: 34,064,080 (GRCm39) V325A probably damaging Het
Slc4a2 G A 5: 24,635,125 (GRCm39) A177T possibly damaging Het
Slc5a4a A G 10: 75,983,428 (GRCm39) N22D unknown Het
Stard13 C T 5: 150,986,232 (GRCm39) W308* probably null Het
Tanc2 C T 11: 105,748,379 (GRCm39) L504F possibly damaging Het
Tfap2e G T 4: 126,614,337 (GRCm39) N282K probably damaging Het
Usp36 G T 11: 118,155,731 (GRCm39) T682K possibly damaging Het
Zc3h11a T C 1: 133,561,527 (GRCm39) T315A probably benign Het
Zfa-ps T A 10: 52,419,118 (GRCm39) noncoding transcript Het
Zfp1002 A T 2: 150,097,410 (GRCm39) Y34* probably null Het
Zfp663 A T 2: 165,195,590 (GRCm39) C210S possibly damaging Het
Zfp747 T C 7: 126,973,566 (GRCm39) I201M probably damaging Het
Zic4 C T 9: 91,266,205 (GRCm39) T276M probably damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
R9710:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GATCCTCCTGAGAATGGCAG -3'
(R):5'- TGCTGTCTGTTATCACCAGGC -3'

Sequencing Primer
(F):5'- TCCTCCTGAGAATGGCAGATAAGC -3'
(R):5'- GGACCATTAGCTCTACATGATGACTC -3'
Posted On 2017-01-06