Mutagenetix > Incidental Mutation

Incidental Mutation 'R5041:Unc13b'

452797

Institutional Source

Beutler Lab

Gene Symbol

Unc13b

Ensembl Gene

ENSMUSG00000028456

Gene Name

unc-13 homolog B (C. elegans)

Synonyms

Unc13h2, Munc13-2

MMRRC Submission

042631-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.298) question?

Stock #

R5041 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43058953-43264871 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43237836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 3452 (H3452Q)

Ref Sequence

ENSEMBL: ENSMUSP00000147100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079978] [ENSMUST00000107952] [ENSMUST00000107953] [ENSMUST00000163653] [ENSMUST00000207569] [ENSMUST00000207708]

AlphaFold

Q9Z1N9

Predicted Effect

probably benign
Transcript: ENSMUST00000079978
AA Change: H652Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000078894
Gene: ENSMUSG00000028456
AA Change: H652Q

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1262	1404	4.8e-60	PFAM
C2	1438	1544	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107952
AA Change: H664Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000103586
Gene: ENSMUSG00000028456
AA Change: H664Q

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1033	2.02e-53	SMART
Pfam:Membr_traf_MHD	1274	1416	4.8e-60	PFAM
C2	1450	1556	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107953
AA Change: H652Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103587
Gene: ENSMUSG00000028456
AA Change: H652Q

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	179	193	N/A	INTRINSIC
low complexity region	292	303	N/A	INTRINSIC
low complexity region	322	333	N/A	INTRINSIC
C1	478	527	4.21e-18	SMART
C2	601	708	2.07e-22	SMART
DUF1041	917	1021	2.02e-53	SMART
Pfam:Membr_traf_MHD	1263	1403	2.3e-56	PFAM
C2	1457	1563	7.56e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127597

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132310

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149945

Predicted Effect

probably benign
Transcript: ENSMUST00000163653
AA Change: H664Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000128608
Gene: ENSMUSG00000028456
AA Change: H664Q

Domain	Start	End	E-Value	Type
C2	3	94	1.2e-9	SMART
low complexity region	191	205	N/A	INTRINSIC
low complexity region	304	315	N/A	INTRINSIC
low complexity region	334	345	N/A	INTRINSIC
C1	490	539	4.21e-18	SMART
C2	613	720	2.07e-22	SMART
DUF1041	929	1032	4.64e-53	SMART
Pfam:Membr_traf_MHD	1273	1415	4.8e-60	PFAM
C2	1449	1555	7.56e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168032

SMART Domains

Protein: ENSMUSP00000132622
Gene: ENSMUSG00000028456

Domain	Start	End	E-Value	Type
C1	147	196	4.21e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000207569
AA Change: H3452Q

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000207708
AA Change: H1025Q

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.1021

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.5%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in the kidney cortical epithelial cells and is upregulated by hyperglycemia. The encoded protein shares a high level of similarity to the rat homolog, and contains 3 C2 domains and a diacylglycerol-binding C1 domain. Hyperglycemia increases the levels of diacylglycerol, which has been shown to induce apoptosis in cells transfected with this gene and thus contribute to the renal cell complications of hyperglycemia. Studies in other species also indicate a role for this protein in the priming step of synaptic vesicle exocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are grossly phenotypically normal. Mice older than 12 months will exhibit sporadic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg7	A	G	16: 56,730,348	F667S	probably benign	Het
Akna	A	G	4: 63,387,144	Y462H	possibly damaging	Het
Anxa11	G	T	14: 25,874,764	E278*	probably null	Het
Ap3s2	T	C	7: 79,920,519	Y20C	probably benign	Het
Atxn7	T	C	14: 14,096,317		probably null	Het
AW551984	T	C	9: 39,600,598	Y39C	probably damaging	Het
Becn1	A	T	11: 101,288,836	S442T	probably benign	Het
Bhlhe40	C	T	6: 108,662,585	T108I	probably damaging	Het
Cnst	A	G	1: 179,605,028	D252G	probably damaging	Het
Cpxm1	A	G	2: 130,394,070	S391P	probably damaging	Het
Ctnna2	T	A	6: 76,915,763	N814Y	probably damaging	Het
Ddx3y	T	A	Y: 1,266,611	Y282F	probably benign	Het
Ddx56	A	G	11: 6,264,178	V357A	probably damaging	Het
Frmpd1	T	G	4: 45,278,878	C534W	probably damaging	Het
Gimap8	A	G	6: 48,659,163	N621D	probably damaging	Het
Gm13023	T	C	4: 143,793,690	V4A	probably benign	Het
Herc1	T	A	9: 66,429,045	I1624N	possibly damaging	Het
Htr7	A	C	19: 36,057,067	W63G	probably benign	Het
Ly6g6c	T	A	17: 35,065,452		probably null	Het
Macf1	T	C	4: 123,397,046		probably null	Het
Mfrp	A	G	9: 44,102,278	D62G	probably damaging	Het
Ncam1	T	C	9: 49,566,785	Y173C	probably damaging	Het
Nwd1	T	C	8: 72,705,055	V1185A	possibly damaging	Het
Olfr1218	A	T	2: 89,054,921	C168*	probably null	Het
Olfr573-ps1	T	C	7: 102,942,578		probably null	Het
Papd5	CCCAACAACGCCAACAA	CCCAACAA	8: 88,255,250		probably benign	Het
Pcf11	G	A	7: 92,658,405	P852S	probably benign	Het
Ralgapa2	T	C	2: 146,485,151	I63V	probably benign	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Rubcnl	T	C	14: 75,050,132	F619L	probably damaging	Het
Sec24d	A	T	3: 123,294,231	Q247L	probably damaging	Het
Spns3	G	T	11: 72,536,547	Q306K	possibly damaging	Het
Sstr1	T	C	12: 58,213,155	V188A	possibly damaging	Het
Supt5	A	T	7: 28,315,380	L1024Q	probably damaging	Het
Thegl	A	G	5: 77,056,081	T319A	probably benign	Het
Usp28	A	G	9: 49,037,773	Q864R	probably benign	Het
Vmn2r43	T	C	7: 8,244,807	T786A	probably damaging	Het
Yy1	TCACCACCACCACCACCACCACCACCACC	TCACCACCACCACCACCACCACCACCACCACC	12: 108,793,631		probably benign	Het

Other mutations in Unc13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Unc13b	APN	4	43240285	missense	probably damaging	1.00
IGL00832:Unc13b	APN	4	43258921	missense	probably damaging	1.00
IGL01111:Unc13b	APN	4	43096927	missense	possibly damaging	0.76
IGL01115:Unc13b	APN	4	43258492	missense	probably damaging	1.00
IGL01137:Unc13b	APN	4	43091291	missense	probably damaging	1.00
IGL01637:Unc13b	APN	4	43241066	missense	probably damaging	1.00
IGL01789:Unc13b	APN	4	43239462	missense	probably damaging	1.00
IGL01792:Unc13b	APN	4	43250218	missense	probably damaging	0.99
IGL01877:Unc13b	APN	4	43249583	critical splice donor site	probably null
IGL01924:Unc13b	APN	4	43239385	nonsense	probably null
IGL02087:Unc13b	APN	4	43091270	missense	probably null	1.00
IGL02197:Unc13b	APN	4	43165828	missense	probably damaging	0.99
IGL02504:Unc13b	APN	4	43263031	missense	probably damaging	1.00
IGL02659:Unc13b	APN	4	43235332	missense	probably damaging	1.00
IGL03031:Unc13b	APN	4	43235368	missense	probably damaging	1.00
IGL03036:Unc13b	APN	4	43235249	missense	probably damaging	1.00
IGL03209:Unc13b	APN	4	43239351	missense	probably damaging	0.99
IGL03352:Unc13b	APN	4	43237110	missense	possibly damaging	0.90
BB006:Unc13b	UTSW	4	43174399	missense	unknown
BB016:Unc13b	UTSW	4	43174399	missense	unknown
G1Funyon:Unc13b	UTSW	4	43263568	missense	probably benign
P0028:Unc13b	UTSW	4	43256225	missense	probably damaging	1.00
PIT4585001:Unc13b	UTSW	4	43091298	missense	probably benign	0.03
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0019:Unc13b	UTSW	4	43096990	missense	possibly damaging	0.58
R0335:Unc13b	UTSW	4	43236983	missense	possibly damaging	0.95
R0504:Unc13b	UTSW	4	43263559	missense	probably damaging	0.99
R0631:Unc13b	UTSW	4	43182849	missense	possibly damaging	0.47
R0748:Unc13b	UTSW	4	43241164	splice site	probably benign
R1275:Unc13b	UTSW	4	43235366	missense	probably damaging	1.00
R1293:Unc13b	UTSW	4	43235190	missense	probably damaging	1.00
R1434:Unc13b	UTSW	4	43239385	nonsense	probably null
R1552:Unc13b	UTSW	4	43237144	missense	probably damaging	0.99
R1591:Unc13b	UTSW	4	43244747	missense	probably damaging	1.00
R1628:Unc13b	UTSW	4	43263371	missense	probably damaging	1.00
R1740:Unc13b	UTSW	4	43240285	missense	probably damaging	1.00
R1839:Unc13b	UTSW	4	43258308	splice site	probably benign
R2045:Unc13b	UTSW	4	43091266	missense	probably damaging	1.00
R2191:Unc13b	UTSW	4	43245566	nonsense	probably null
R2259:Unc13b	UTSW	4	43182780	missense	possibly damaging	0.87
R2307:Unc13b	UTSW	4	43239854	missense	probably damaging	0.98
R2317:Unc13b	UTSW	4	43245514	missense	probably damaging	1.00
R2402:Unc13b	UTSW	4	43095843	missense	probably benign
R2847:Unc13b	UTSW	4	43180404	missense	probably benign	0.04
R3414:Unc13b	UTSW	4	43234658	splice site	probably benign
R3436:Unc13b	UTSW	4	43097028	splice site	probably benign
R3955:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R3957:Unc13b	UTSW	4	43256834	missense	probably damaging	1.00
R4015:Unc13b	UTSW	4	43237801	missense	probably damaging	1.00
R4650:Unc13b	UTSW	4	43261035	missense	probably damaging	0.97
R4836:Unc13b	UTSW	4	43237137	missense	probably damaging	1.00
R5413:Unc13b	UTSW	4	43257936	critical splice donor site	probably null
R5994:Unc13b	UTSW	4	43172596	intron	probably benign
R6015:Unc13b	UTSW	4	43177995	nonsense	probably null
R6090:Unc13b	UTSW	4	43239306	missense	probably damaging	1.00
R6242:Unc13b	UTSW	4	43165800	missense	possibly damaging	0.92
R6246:Unc13b	UTSW	4	43216246	missense	probably benign	0.18
R6427:Unc13b	UTSW	4	43176966	unclassified	probably benign
R6660:Unc13b	UTSW	4	43177412	unclassified	probably benign
R6670:Unc13b	UTSW	4	43255562	missense	probably damaging	0.99
R6753:Unc13b	UTSW	4	43239331	missense	probably damaging	1.00
R6858:Unc13b	UTSW	4	43165828	missense	possibly damaging	0.85
R6886:Unc13b	UTSW	4	43170156	intron	probably benign
R6969:Unc13b	UTSW	4	43263538	missense	possibly damaging	0.94
R6994:Unc13b	UTSW	4	43171403	intron	probably benign
R6994:Unc13b	UTSW	4	43173203	intron	probably benign
R7080:Unc13b	UTSW	4	43171926	missense	unknown
R7117:Unc13b	UTSW	4	43216544	missense	probably benign	0.33
R7132:Unc13b	UTSW	4	43215757	missense	probably benign	0.17
R7181:Unc13b	UTSW	4	43258893	missense	probably damaging	0.99
R7192:Unc13b	UTSW	4	43258519	missense	probably damaging	1.00
R7246:Unc13b	UTSW	4	43172910	missense	unknown
R7342:Unc13b	UTSW	4	43258703	missense	probably damaging	0.99
R7345:Unc13b	UTSW	4	43173966	missense	unknown
R7355:Unc13b	UTSW	4	43237754	missense	probably damaging	1.00
R7391:Unc13b	UTSW	4	43216459	missense	probably benign	0.03
R7419:Unc13b	UTSW	4	43174023	missense	unknown
R7424:Unc13b	UTSW	4	43172235	missense	unknown
R7517:Unc13b	UTSW	4	43215765	missense	probably benign
R7532:Unc13b	UTSW	4	43249565	missense	probably benign	0.44
R7564:Unc13b	UTSW	4	43091258	missense	probably damaging	1.00
R7598:Unc13b	UTSW	4	43263569	missense	probably benign	0.20
R7604:Unc13b	UTSW	4	43170102	missense	unknown
R7604:Unc13b	UTSW	4	43256776	missense	possibly damaging	0.95
R7643:Unc13b	UTSW	4	43216333	missense	probably benign
R7718:Unc13b	UTSW	4	43173854	missense	unknown
R7735:Unc13b	UTSW	4	43165791	missense	probably damaging	1.00
R7756:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177312	small deletion	probably benign
R7757:Unc13b	UTSW	4	43177330	small insertion	probably benign
R7757:Unc13b	UTSW	4	43177341	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177312	small insertion	probably benign
R7758:Unc13b	UTSW	4	43177344	small insertion	probably benign
R7781:Unc13b	UTSW	4	43259546	missense	possibly damaging	0.87
R7793:Unc13b	UTSW	4	43172737	missense	unknown
R7858:Unc13b	UTSW	4	43176285	missense	unknown
R7867:Unc13b	UTSW	4	43232573	nonsense	probably null
R7897:Unc13b	UTSW	4	43171860	missense	unknown
R7904:Unc13b	UTSW	4	43217075	missense	probably benign
R7929:Unc13b	UTSW	4	43174399	missense	unknown
R7984:Unc13b	UTSW	4	43173973	missense	unknown
R8069:Unc13b	UTSW	4	43177597	missense	unknown
R8101:Unc13b	UTSW	4	43239918	missense	probably benign	0.08
R8246:Unc13b	UTSW	4	43175954	missense	unknown
R8289:Unc13b	UTSW	4	43172524	nonsense	probably null
R8301:Unc13b	UTSW	4	43263568	missense	probably benign
R8397:Unc13b	UTSW	4	43217290	missense	probably benign	0.12
R8421:Unc13b	UTSW	4	43178304	missense	unknown
R8738:Unc13b	UTSW	4	43177564	missense	unknown
R8746:Unc13b	UTSW	4	43176120	missense	unknown
R8766:Unc13b	UTSW	4	43174722	missense	unknown
R8825:Unc13b	UTSW	4	43237683	splice site	probably benign
R8834:Unc13b	UTSW	4	43175954	missense	unknown
R8862:Unc13b	UTSW	4	43235207	missense	probably damaging	1.00
R8864:Unc13b	UTSW	4	43174724	missense	unknown
R8889:Unc13b	UTSW	4	43176484	missense	unknown
R8892:Unc13b	UTSW	4	43176484	missense	unknown
R8904:Unc13b	UTSW	4	43178531	intron	probably benign
R9089:Unc13b	UTSW	4	43095847	missense	probably damaging	1.00
R9144:Unc13b	UTSW	4	43173649	missense	unknown
R9149:Unc13b	UTSW	4	43176186	missense	unknown
R9173:Unc13b	UTSW	4	43177421	missense	unknown
R9200:Unc13b	UTSW	4	43257352	missense	possibly damaging	0.50
R9232:Unc13b	UTSW	4	43240321	missense	probably benign	0.03
R9269:Unc13b	UTSW	4	43171955	missense	unknown
R9320:Unc13b	UTSW	4	43171044	missense	unknown
R9335:Unc13b	UTSW	4	43216123	missense	possibly damaging	0.86
R9335:Unc13b	UTSW	4	43255551	missense	probably damaging	0.99
R9352:Unc13b	UTSW	4	43177312	small insertion	probably benign
R9352:Unc13b	UTSW	4	43177313	nonsense	probably null
R9378:Unc13b	UTSW	4	43173282	missense	unknown
R9382:Unc13b	UTSW	4	43172512	missense	unknown
R9569:Unc13b	UTSW	4	43177312	small deletion	probably benign
RF016:Unc13b	UTSW	4	43177347	small insertion	probably benign
RF016:Unc13b	UTSW	4	43177350	small insertion	probably benign
RF041:Unc13b	UTSW	4	43177338	small insertion	probably benign
RF056:Unc13b	UTSW	4	43177359	small insertion	probably benign
Z1176:Unc13b	UTSW	4	43171419	missense	unknown
Z1176:Unc13b	UTSW	4	43177191	missense	unknown
Z1176:Unc13b	UTSW	4	43177764	missense	unknown
Z1176:Unc13b	UTSW	4	43261043	missense	probably benign	0.11
Z1177:Unc13b	UTSW	4	43173669	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTGATTTAACTCTGACATGTGCC -3'
(R):5'- AAAGCACTGGCCATAAACGG -3'

Sequencing Primer
(F):5'- TTAACTCTGACATGTGCCCTAAAC -3'
(R):5'- CGGACCTCATTAATACAGTATCTGGG -3'

Posted On

2017-01-06