Incidental Mutation 'R5041:Thegl'
ID452798
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77056081 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 319 (T319A)
Ref Sequence ENSEMBL: ENSMUSP00000112814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably benign
Transcript: ENSMUST00000031161
AA Change: T319A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248
AA Change: T319A

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117880
AA Change: T319A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248
AA Change: T319A

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7453:Thegl UTSW 5 77060786 missense probably damaging 1.00
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGCATGCGTGTGGGAAAAG -3'
(R):5'- GAGTTCCACCTCTAATACAGTGGAG -3'

Sequencing Primer
(F):5'- AGCATGTGCACACCTGTAG -3'
(R):5'- GTGGAGCCACAAATTGCTATGCC -3'
Posted On2017-01-06