Incidental Mutation 'R5041:Ly6g6c'
ID452800
Institutional Source Beutler Lab
Gene Symbol Ly6g6c
Ensembl Gene ENSMUSG00000092586
Gene Namelymphocyte antigen 6 complex, locus G6C
Synonyms1110003M04Rik, G6c, NG24
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35065388-35070050 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 35065452 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007255] [ENSMUST00000097337] [ENSMUST00000173207] [ENSMUST00000173478] [ENSMUST00000173520] [ENSMUST00000174190] [ENSMUST00000174493] [ENSMUST00000174876]
Predicted Effect probably benign
Transcript: ENSMUST00000007255
SMART Domains Protein: ENSMUSP00000007255
Gene: ENSMUSG00000007039

DomainStartEndE-ValueType
PDB:2JAJ|B 1 282 1e-77 PDB
SCOP:d1h70a_ 13 277 1e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097337
SMART Domains Protein: ENSMUSP00000094950
Gene: ENSMUSG00000073414

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 20 121 3.27e0 SMART
low complexity region 145 160 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173207
SMART Domains Protein: ENSMUSP00000134194
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Blast:LU 48 136 3e-57 BLAST
low complexity region 139 151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173478
SMART Domains Protein: ENSMUSP00000133510
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LU 22 110 2e-57 BLAST
low complexity region 113 125 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173520
SMART Domains Protein: ENSMUSP00000134595
Gene: ENSMUSG00000007039

DomainStartEndE-ValueType
Pfam:Amidinotransf 28 157 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173562
Predicted Effect probably benign
Transcript: ENSMUST00000174190
SMART Domains Protein: ENSMUSP00000133377
Gene: ENSMUSG00000073414

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 20 121 3.27e0 SMART
low complexity region 145 160 N/A INTRINSIC
low complexity region 168 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174493
SMART Domains Protein: ENSMUSP00000134072
Gene: ENSMUSG00000007039

DomainStartEndE-ValueType
Pfam:Amidinotransf 30 232 5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174876
SMART Domains Protein: ENSMUSP00000133838
Gene: ENSMUSG00000092586

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LU 22 56 9e-18 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LY6G6C belongs to a cluster of leukocyte antigen-6 (LY6) genes located in the major histocompatibility complex (MHC) class III region on chromosome 6. Members of the LY6 superfamily typically contain 70 to 80 amino acids, including 8 to 10 cysteines. Most LY6 proteins are attached to the cell surface by a glycosylphosphatidylinositol (GPI) anchor that is directly involved in signal transduction (Mallya et al., 2002 [PubMed 12079290]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Olfr573-ps1 T C 7: 102,942,578 probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Ly6g6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03047:Ly6g6c UTSW 17 35069349 unclassified probably null
R0099:Ly6g6c UTSW 17 35068915 missense probably damaging 0.97
R4876:Ly6g6c UTSW 17 35069440 missense probably damaging 1.00
R6811:Ly6g6c UTSW 17 35069410 missense probably damaging 1.00
R7078:Ly6g6c UTSW 17 35069461 missense probably damaging 1.00
R7208:Ly6g6c UTSW 17 35067411 missense unknown
R8092:Ly6g6c UTSW 17 35068891 missense probably damaging 1.00
X0062:Ly6g6c UTSW 17 35069356 unclassified probably null
Predicted Primers PCR Primer
(F):5'- TGTAAAGGTTAGGGCTCTGC -3'
(R):5'- TTTTCTGCAAAGGACGCCAC -3'

Sequencing Primer
(F):5'- TGACTGGTCACACCCTGTTTCAAG -3'
(R):5'- GAATGAGAGTCGCACAGTGCTTC -3'
Posted On2017-01-06