Incidental Mutation 'R5042:Nfatc3'
ID452805
Institutional Source Beutler Lab
Gene Symbol Nfatc3
Ensembl Gene ENSMUSG00000031902
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 3
SynonymsNFATx, NFAT4, D8Ertd281e
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106058840-106130537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106108125 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 701 (V701A)
Ref Sequence ENSEMBL: ENSMUSP00000104931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109308] [ENSMUST00000211991] [ENSMUST00000212742]
Predicted Effect probably benign
Transcript: ENSMUST00000109308
AA Change: V701A

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000104931
Gene: ENSMUSG00000031902
AA Change: V701A

DomainStartEndE-ValueType
low complexity region 153 182 N/A INTRINSIC
low complexity region 205 225 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 286 305 N/A INTRINSIC
Pfam:RHD_DNA_bind 434 593 4.9e-25 PFAM
IPT 600 699 1.19e-20 SMART
low complexity region 713 722 N/A INTRINSIC
low complexity region 917 938 N/A INTRINSIC
low complexity region 954 967 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211991
AA Change: V693A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000212742
AA Change: V693A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0591 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the nuclear factors of activated T cells DNA-binding transcription complex. This complex consists of at least two components: a preexisting cytosolic component that translocates to the nucleus upon T cell receptor (TCR) stimulation and an inducible nuclear component. Other members of this family participate to form this complex also. The product of this gene plays a role in the regulation of gene expression in T cells and immature thymocytes. Several transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience some embryonic lethality and reduced body size. Developmental defects also exist in the immune system , skeletal muscle, vasculature, heart, and sensory nerves. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Iqch A G 9: 63,496,234 M634T possibly damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Nfatc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nfatc3 APN 8 106099177 missense probably damaging 1.00
IGL01755:Nfatc3 APN 8 106127921 missense probably benign 0.42
IGL02314:Nfatc3 APN 8 106078900 missense probably benign 0.21
IGL02724:Nfatc3 APN 8 106108185 missense probably benign 0.29
Struggles UTSW 8 106083870 nonsense probably null
PIT1430001:Nfatc3 UTSW 8 106059973 missense possibly damaging 0.78
PIT4515001:Nfatc3 UTSW 8 106079203 missense possibly damaging 0.94
R0088:Nfatc3 UTSW 8 106127942 missense possibly damaging 0.90
R0348:Nfatc3 UTSW 8 106092195 missense probably damaging 1.00
R0410:Nfatc3 UTSW 8 106096196 missense probably damaging 1.00
R1509:Nfatc3 UTSW 8 106083854 missense possibly damaging 0.46
R1702:Nfatc3 UTSW 8 106092160 missense probably damaging 1.00
R1735:Nfatc3 UTSW 8 106083834 missense probably damaging 1.00
R1736:Nfatc3 UTSW 8 106078850 missense probably damaging 1.00
R1758:Nfatc3 UTSW 8 106099136 missense probably damaging 1.00
R2370:Nfatc3 UTSW 8 106108455 missense probably damaging 1.00
R2878:Nfatc3 UTSW 8 106092144 missense probably damaging 1.00
R3802:Nfatc3 UTSW 8 106079645 missense probably damaging 0.99
R3959:Nfatc3 UTSW 8 106099077 nonsense probably null
R4006:Nfatc3 UTSW 8 106108839 missense probably benign 0.00
R4079:Nfatc3 UTSW 8 106079491 missense probably damaging 0.98
R4589:Nfatc3 UTSW 8 106079073 missense probably damaging 1.00
R4818:Nfatc3 UTSW 8 106108379 missense probably benign 0.00
R4907:Nfatc3 UTSW 8 106079727 missense probably damaging 1.00
R5632:Nfatc3 UTSW 8 106079057 missense probably damaging 1.00
R5741:Nfatc3 UTSW 8 106079066 missense probably damaging 1.00
R5885:Nfatc3 UTSW 8 106096312 missense probably benign 0.00
R6439:Nfatc3 UTSW 8 106083870 nonsense probably null
R6557:Nfatc3 UTSW 8 106119354 missense probably benign 0.01
R6737:Nfatc3 UTSW 8 106083969 missense probably damaging 1.00
R6925:Nfatc3 UTSW 8 106119322 missense probably benign 0.00
R7260:Nfatc3 UTSW 8 106108946 missense probably benign 0.00
R7429:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7430:Nfatc3 UTSW 8 106108403 missense probably benign 0.00
R7526:Nfatc3 UTSW 8 106079083 missense probably damaging 1.00
X0063:Nfatc3 UTSW 8 106083939 missense probably damaging 1.00
X0064:Nfatc3 UTSW 8 106108349 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCACTGCTTATGTCAGACTAGC -3'
(R):5'- TGGGTGGAGGCTACCATAGATG -3'

Sequencing Primer
(F):5'- CTAGCTGGTTTATGAGCTTCTAGAAC -3'
(R):5'- AGGCTACCATAGATGTATATGCTGGC -3'
Posted On2017-01-06