Incidental Mutation 'R5042:Iqch'
ID452807
Institutional Source Beutler Lab
Gene Symbol Iqch
Ensembl Gene ENSMUSG00000037801
Gene NameIQ motif containing H
Synonyms4921504K03Rik
MMRRC Submission 042632-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5042 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location63421455-63602493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63496234 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 634 (M634T)
Ref Sequence ENSEMBL: ENSMUSP00000131828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042322] [ENSMUST00000080527] [ENSMUST00000163624] [ENSMUST00000163982] [ENSMUST00000171243]
Predicted Effect probably benign
Transcript: ENSMUST00000042322
AA Change: M673T

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047953
Gene: ENSMUSG00000037801
AA Change: M673T

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080527
AA Change: M673T

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000079370
Gene: ENSMUSG00000037801
AA Change: M673T

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126238
Predicted Effect probably benign
Transcript: ENSMUST00000163624
AA Change: M673T

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128482
Gene: ENSMUSG00000037801
AA Change: M673T

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163982
AA Change: M673T

PolyPhen 2 Score 0.347 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126546
Gene: ENSMUSG00000037801
AA Change: M673T

DomainStartEndE-ValueType
low complexity region 257 267 N/A INTRINSIC
IQ 405 427 2.79e0 SMART
low complexity region 479 491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000171243
AA Change: M634T

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131828
Gene: ENSMUSG00000037801
AA Change: M634T

DomainStartEndE-ValueType
low complexity region 218 228 N/A INTRINSIC
IQ 366 388 2.79e0 SMART
low complexity region 440 452 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191455
Meta Mutation Damage Score 0.1361 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.8%
Validation Efficiency 100% (57/57)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,502 noncoding transcript Het
4933413J09Rik C A 14: 26,376,281 noncoding transcript Het
Aldh1a2 A G 9: 71,285,004 I413V possibly damaging Het
Alpk2 C T 18: 65,350,508 W143* probably null Het
Anpep G T 7: 79,839,469 N318K probably benign Het
Art5 A T 7: 102,099,465 L10H probably damaging Het
Atg2b T G 12: 105,621,262 H1981P probably benign Het
B3gnt3 T C 8: 71,692,888 T279A probably damaging Het
Bmp10 G T 6: 87,434,057 E277D probably damaging Het
Ccdc180 A G 4: 45,916,255 T191A probably damaging Het
Dars2 T A 1: 161,045,094 probably benign Het
F5 T A 1: 164,219,451 I2160N probably damaging Het
Fndc7 A T 3: 108,862,786 V608D probably damaging Het
Gad1-ps A T 10: 99,445,654 noncoding transcript Het
Gbp2b A G 3: 142,611,463 K527E probably benign Het
Gm10719 T A 9: 3,018,970 F72I probably damaging Het
Hes3 T A 4: 152,287,043 S150C possibly damaging Het
Hp1bp3 T A 4: 138,222,108 M1K probably null Het
Il17rd T A 14: 27,096,041 V229E probably damaging Het
Magel2 C T 7: 62,379,606 R753W unknown Het
Med26 A G 8: 72,497,075 V60A probably damaging Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Nat1 T G 8: 67,491,576 D201E probably benign Het
Nav3 G T 10: 109,769,268 S981R probably benign Het
Nbn C A 4: 15,981,446 L513M probably benign Het
Nfatc3 T C 8: 106,108,125 V701A probably benign Het
Nlrp9a A G 7: 26,571,278 D911G probably damaging Het
Npr2 A T 4: 43,647,002 I712F probably damaging Het
Olfr514 A G 7: 108,825,471 I176T possibly damaging Het
Oplah G A 15: 76,305,709 R235* probably null Het
Pcdha11 T A 18: 37,011,596 Y247N probably damaging Het
Pcdhga9 A G 18: 37,737,577 Y153C probably damaging Het
Pkd1 A T 17: 24,569,887 D873V probably benign Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Ppfia3 A G 7: 45,342,341 V839A probably damaging Het
Ppm1j A T 3: 104,782,720 Q148L probably null Het
Prune2 T A 19: 17,119,797 N888K possibly damaging Het
Sh3bgr A G 16: 96,205,866 D12G probably benign Het
Snph T A 2: 151,601,057 I35F possibly damaging Het
Spag17 A T 3: 100,072,149 D1442V probably damaging Het
Spidr T C 16: 16,118,903 T113A probably benign Het
St13 A T 15: 81,365,492 N349K probably damaging Het
Ttll6 C T 11: 96,154,604 S549F possibly damaging Het
Uap1l1 A T 2: 25,362,085 S473T possibly damaging Het
Vmn1r54 T C 6: 90,269,440 V112A possibly damaging Het
Vmn2r57 G A 7: 41,428,662 S124L probably benign Het
Wasf2 A T 4: 133,176,564 R28W probably benign Het
Wwp2 T A 8: 107,548,485 N417K possibly damaging Het
Zc3h13 A T 14: 75,339,396 D1648V probably damaging Het
Other mutations in Iqch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Iqch APN 9 63480654 missense probably damaging 0.96
IGL01472:Iqch APN 9 63547934 missense probably benign 0.02
IGL01553:Iqch APN 9 63500917 missense probably benign 0.00
IGL01611:Iqch APN 9 63496237 critical splice acceptor site probably null
IGL02608:Iqch APN 9 63421828 unclassified probably benign
IGL03060:Iqch APN 9 63524914 missense probably damaging 1.00
IGL03154:Iqch APN 9 63454682 missense probably damaging 0.97
museum UTSW 9 63525139 nonsense probably null
I2288:Iqch UTSW 9 63500890 missense probably benign 0.01
R0002:Iqch UTSW 9 63594743 splice site probably benign
R0350:Iqch UTSW 9 63500876 missense probably benign 0.43
R0532:Iqch UTSW 9 63508232 splice site probably benign
R0629:Iqch UTSW 9 63425382 missense probably benign 0.22
R0710:Iqch UTSW 9 63525136 missense probably benign
R0766:Iqch UTSW 9 63482683 missense probably benign 0.02
R1797:Iqch UTSW 9 63588377 missense possibly damaging 0.58
R1856:Iqch UTSW 9 63534337 splice site probably null
R1954:Iqch UTSW 9 63548016 missense probably benign 0.00
R1955:Iqch UTSW 9 63548016 missense probably benign 0.00
R2184:Iqch UTSW 9 63525069 missense probably damaging 0.99
R2264:Iqch UTSW 9 63512299 missense probably benign 0.27
R4614:Iqch UTSW 9 63482581 missense probably benign
R4643:Iqch UTSW 9 63594802 missense probably benign 0.00
R4654:Iqch UTSW 9 63524913 missense probably damaging 0.99
R4665:Iqch UTSW 9 63445571 missense probably damaging 1.00
R5027:Iqch UTSW 9 63525012 missense possibly damaging 0.87
R5551:Iqch UTSW 9 63496253 splice site probably null
R5829:Iqch UTSW 9 63425357 critical splice donor site probably null
R5878:Iqch UTSW 9 63547990 missense probably damaging 0.99
R6816:Iqch UTSW 9 63480759 missense probably benign 0.02
R6930:Iqch UTSW 9 63480574 missense possibly damaging 0.79
R7000:Iqch UTSW 9 63454610 missense probably benign
R7026:Iqch UTSW 9 63525139 nonsense probably null
R7066:Iqch UTSW 9 63524745 missense probably benign 0.24
R7111:Iqch UTSW 9 63512317 missense possibly damaging 0.79
R7129:Iqch UTSW 9 63421909 missense probably benign 0.09
R7177:Iqch UTSW 9 63421835 makesense probably null
R7252:Iqch UTSW 9 63512236 critical splice donor site probably null
R7485:Iqch UTSW 9 63508317 missense possibly damaging 0.47
R7541:Iqch UTSW 9 63445521 missense possibly damaging 0.95
R7805:Iqch UTSW 9 63421720 splice site probably null
R7973:Iqch UTSW 9 63524946 missense possibly damaging 0.79
R8113:Iqch UTSW 9 63454573 missense probably benign 0.00
R8170:Iqch UTSW 9 63429030 missense probably damaging 1.00
R8218:Iqch UTSW 9 63482633 missense possibly damaging 0.60
X0066:Iqch UTSW 9 63429058 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGTTACCACTGAACACTCACTTG -3'
(R):5'- TGGCTTTTATCCCATTGGCTAG -3'

Sequencing Primer
(F):5'- ACTGAACACTCACTTGTGCCC -3'
(R):5'- ATCCCATTGGCTAGTGATTTCTC -3'
Posted On2017-01-06