Mutagenetix > Incidental Mutations

Incidental Mutation 'R5042:Atg2b'

452808

Institutional Source

Beutler Lab

Gene Symbol

Atg2b

Ensembl Gene

ENSMUSG00000041341

Gene Name

autophagy related 2B

Synonyms

MMRRC Submission

042632-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.260) question?

Stock #

R5042 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

105616136-105685211 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 105621262 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 1981 (H1981P)

Ref Sequence

ENSEMBL: ENSMUSP00000037441 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041055]

Predicted Effect

probably benign
Transcript: ENSMUST00000041055
AA Change: H1981P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341
AA Change: H1981P

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	11	127	3.5e-19	PFAM
low complexity region	286	298	N/A	INTRINSIC
low complexity region	409	428	N/A	INTRINSIC
low complexity region	864	870	N/A	INTRINSIC
low complexity region	893	904	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
Pfam:ATG_C	1976	2071	1.4e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220960

Predicted Effect

unknown
Transcript: ENSMUST00000221015
AA Change: H821P

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222395

Meta Mutation Damage Score

0.0738

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.8%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein required for autophagy. The encoded protein is involved in autophagosome formation. A germline duplication of a region that includes this gene is associated with predisposition to myeloid malignancies. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930432E11Rik	T	A	7: 29,574,502		noncoding transcript	Het
4933413J09Rik	C	A	14: 26,376,281		noncoding transcript	Het
Aldh1a2	A	G	9: 71,285,004	I413V	possibly damaging	Het
Alpk2	C	T	18: 65,350,508	W143*	probably null	Het
Anpep	G	T	7: 79,839,469	N318K	probably benign	Het
Art5	A	T	7: 102,099,465	L10H	probably damaging	Het
B3gnt3	T	C	8: 71,692,888	T279A	probably damaging	Het
Bmp10	G	T	6: 87,434,057	E277D	probably damaging	Het
Ccdc180	A	G	4: 45,916,255	T191A	probably damaging	Het
Dars2	T	A	1: 161,045,094		probably benign	Het
F5	T	A	1: 164,219,451	I2160N	probably damaging	Het
Fndc7	A	T	3: 108,862,786	V608D	probably damaging	Het
Gad1-ps	A	T	10: 99,445,654		noncoding transcript	Het
Gbp2b	A	G	3: 142,611,463	K527E	probably benign	Het
Gm10719	T	A	9: 3,018,970	F72I	probably damaging	Het
Hes3	T	A	4: 152,287,043	S150C	possibly damaging	Het
Hp1bp3	T	A	4: 138,222,108	M1K	probably null	Het
Il17rd	T	A	14: 27,096,041	V229E	probably damaging	Het
Iqch	A	G	9: 63,496,234	M634T	possibly damaging	Het
Magel2	C	T	7: 62,379,606	R753W	unknown	Het
Med26	A	G	8: 72,497,075	V60A	probably damaging	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Nat1	T	G	8: 67,491,576	D201E	probably benign	Het
Nav3	G	T	10: 109,769,268	S981R	probably benign	Het
Nbn	C	A	4: 15,981,446	L513M	probably benign	Het
Nfatc3	T	C	8: 106,108,125	V701A	probably benign	Het
Nlrp9a	A	G	7: 26,571,278	D911G	probably damaging	Het
Npr2	A	T	4: 43,647,002	I712F	probably damaging	Het
Olfr514	A	G	7: 108,825,471	I176T	possibly damaging	Het
Oplah	G	A	15: 76,305,709	R235*	probably null	Het
Pcdha11	T	A	18: 37,011,596	Y247N	probably damaging	Het
Pcdhga9	A	G	18: 37,737,577	Y153C	probably damaging	Het
Pkd1	A	T	17: 24,569,887	D873V	probably benign	Het
Pnpla1	A	G	17: 28,881,047	N296S	probably benign	Het
Ppfia3	A	G	7: 45,342,341	V839A	probably damaging	Het
Ppm1j	A	T	3: 104,782,720	Q148L	probably null	Het
Prune2	T	A	19: 17,119,797	N888K	possibly damaging	Het
Sh3bgr	A	G	16: 96,205,866	D12G	probably benign	Het
Snph	T	A	2: 151,601,057	I35F	possibly damaging	Het
Spag17	A	T	3: 100,072,149	D1442V	probably damaging	Het
Spidr	T	C	16: 16,118,903	T113A	probably benign	Het
St13	A	T	15: 81,365,492	N349K	probably damaging	Het
Ttll6	C	T	11: 96,154,604	S549F	possibly damaging	Het
Uap1l1	A	T	2: 25,362,085	S473T	possibly damaging	Het
Vmn1r54	T	C	6: 90,269,440	V112A	possibly damaging	Het
Vmn2r57	G	A	7: 41,428,662	S124L	probably benign	Het
Wasf2	A	T	4: 133,176,564	R28W	probably benign	Het
Wwp2	T	A	8: 107,548,485	N417K	possibly damaging	Het
Zc3h13	A	T	14: 75,339,396	D1648V	probably damaging	Het

Other mutations in Atg2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Atg2b	APN	12	105644916	missense	probably benign	0.20
IGL01326:Atg2b	APN	12	105622144	missense	probably damaging	1.00
IGL02063:Atg2b	APN	12	105648322	missense	possibly damaging	0.89
IGL02260:Atg2b	APN	12	105636440	splice site	probably benign
IGL02376:Atg2b	APN	12	105645468	missense	probably damaging	1.00
IGL02381:Atg2b	APN	12	105648348	missense	probably damaging	1.00
IGL02434:Atg2b	APN	12	105639207	missense	probably benign	0.00
IGL02534:Atg2b	APN	12	105643267	missense	probably damaging	1.00
IGL03011:Atg2b	APN	12	105626362	missense	probably damaging	0.98
IGL03173:Atg2b	APN	12	105658294	missense	possibly damaging	0.68
R6669_atg2b_067	UTSW	12	105671529	missense	possibly damaging	0.90
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0066:Atg2b	UTSW	12	105648449	missense	probably benign
R0511:Atg2b	UTSW	12	105617153	missense	probably damaging	1.00
R0762:Atg2b	UTSW	12	105674970	missense	possibly damaging	0.56
R0786:Atg2b	UTSW	12	105636508	missense	probably benign	0.00
R1029:Atg2b	UTSW	12	105635773	missense	probably damaging	0.96
R1529:Atg2b	UTSW	12	105661133	missense	probably benign
R1563:Atg2b	UTSW	12	105623488	missense	probably damaging	0.99
R1746:Atg2b	UTSW	12	105669329	missense	possibly damaging	0.79
R1887:Atg2b	UTSW	12	105654092	missense	probably benign	0.01
R1956:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R1957:Atg2b	UTSW	12	105669418	missense	probably damaging	1.00
R2272:Atg2b	UTSW	12	105638008	missense	probably benign	0.00
R2877:Atg2b	UTSW	12	105664009	nonsense	probably null
R2878:Atg2b	UTSW	12	105664009	nonsense	probably null
R4798:Atg2b	UTSW	12	105652629	missense	probably benign	0.37
R4836:Atg2b	UTSW	12	105646814	missense	probably benign
R5007:Atg2b	UTSW	12	105643876	splice site	probably null
R5134:Atg2b	UTSW	12	105674950	missense	probably damaging	0.96
R5212:Atg2b	UTSW	12	105646796	missense	probably benign	0.00
R5250:Atg2b	UTSW	12	105635765	missense	probably damaging	1.00
R5307:Atg2b	UTSW	12	105658329	missense	probably benign	0.17
R5342:Atg2b	UTSW	12	105658916	missense	possibly damaging	0.90
R5583:Atg2b	UTSW	12	105649155	missense	possibly damaging	0.94
R5656:Atg2b	UTSW	12	105621328	missense	probably benign	0.00
R5660:Atg2b	UTSW	12	105649124	nonsense	probably null
R5903:Atg2b	UTSW	12	105639359	missense	possibly damaging	0.90
R6018:Atg2b	UTSW	12	105661171	missense	probably damaging	0.96
R6153:Atg2b	UTSW	12	105623482	missense	possibly damaging	0.80
R6326:Atg2b	UTSW	12	105661092	nonsense	probably null
R6584:Atg2b	UTSW	12	105657995	missense	probably damaging	1.00
R6593:Atg2b	UTSW	12	105644848	missense	probably damaging	1.00
R6669:Atg2b	UTSW	12	105671529	missense	possibly damaging	0.90
R6847:Atg2b	UTSW	12	105635788	missense	probably damaging	1.00
R7003:Atg2b	UTSW	12	105654249	missense	probably benign	0.01
R7193:Atg2b	UTSW	12	105664708	missense	probably damaging	1.00
R7387:Atg2b	UTSW	12	105622775	missense	probably damaging	1.00
R7432:Atg2b	UTSW	12	105661204	missense	probably damaging	0.98
R7432:Atg2b	UTSW	12	105664698	missense	probably benign	0.08
R7630:Atg2b	UTSW	12	105646954	critical splice acceptor site	probably null
R7634:Atg2b	UTSW	12	105652120	missense	probably damaging	1.00
R7645:Atg2b	UTSW	12	105623430	missense	probably benign	0.06
R7653:Atg2b	UTSW	12	105636472	missense	possibly damaging	0.68
R8157:Atg2b	UTSW	12	105662940	missense	probably damaging	1.00
R8222:Atg2b	UTSW	12	105652216	missense	possibly damaging	0.95
R8469:Atg2b	UTSW	12	105637911	missense	probably benign	0.00
X0018:Atg2b	UTSW	12	105666697	missense	possibly damaging	0.86
X0066:Atg2b	UTSW	12	105646785	missense	probably benign	0.12
Z1177:Atg2b	UTSW	12	105635764	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAAGTCAGTGAAGTCTGCGG -3'
(R):5'- CTGAGTGTTGAAGCAGAGGC -3'

Sequencing Primer
(F):5'- CCTCACTGATGGACTGCAATGTG -3'
(R):5'- GTCTCTGTGGGGCTCTCTTTAC -3'

Posted On

2017-01-06