Incidental Mutation 'R5035:Krt28'
ID452809
Institutional Source Beutler Lab
Gene Symbol Krt28
Ensembl Gene ENSMUSG00000055937
Gene Namekeratin 28
Synonyms
MMRRC Submission 042626-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R5035 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location99364872-99374903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99366824 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 397 (N397S)
Ref Sequence ENSEMBL: ENSMUSP00000006963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006963]
Predicted Effect probably benign
Transcript: ENSMUST00000006963
AA Change: N397S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000006963
Gene: ENSMUSG00000055937
AA Change: N397S

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Filament 83 398 4.6e-144 SMART
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acat1 T C 9: 53,583,510 I361V probably benign Het
Afp A G 5: 90,507,905 D583G probably benign Het
Bcas3 C T 11: 85,543,945 A552V probably damaging Het
Bfsp2 T G 9: 103,479,866 T121P probably benign Het
Bicra C T 7: 15,979,424 R951Q possibly damaging Het
Cdc40 G A 10: 40,849,813 T220I probably benign Het
Cdk5rap3 T C 11: 96,916,085 probably benign Het
Clcnka A T 4: 141,395,158 Y179* probably null Het
Creb3l1 T A 2: 91,987,086 I361F probably benign Het
Csmd3 T C 15: 47,590,779 Y3557C probably damaging Het
Dab2ip A G 2: 35,709,941 S190G probably benign Het
Dbx1 T C 7: 49,632,536 H307R unknown Het
Dock8 C A 19: 25,086,207 P258T probably damaging Het
Eml6 T C 11: 29,854,187 I305V probably benign Het
Frem3 T A 8: 80,615,914 F1612Y probably damaging Het
Fubp1 A G 3: 152,214,851 T76A probably benign Het
Glmp G C 3: 88,326,644 probably benign Het
Gm20918 A G Y: 5,045,992 Q183R probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Map3k13 T C 16: 21,921,671 Y583H probably benign Het
Mcm3 A T 1: 20,803,418 probably benign Het
Misp T C 10: 79,827,956 V588A probably benign Het
Olfr1202 A T 2: 88,818,099 K309N probably benign Het
Olfr348 A G 2: 36,786,891 D122G probably damaging Het
Olfr373 T A 8: 72,100,078 L106H probably damaging Het
Olfr644 G A 7: 104,068,407 T208I possibly damaging Het
Olfr970 G A 9: 39,820,094 A152T possibly damaging Het
Osbpl9 A G 4: 109,066,167 F449L probably damaging Het
Pkhd1l1 A G 15: 44,568,324 D3358G probably damaging Het
Prodh2 A T 7: 30,506,479 S247C possibly damaging Het
Prr23a3 G A 9: 98,865,130 E46K possibly damaging Het
Ptprz1 A G 6: 23,016,215 I837V probably benign Het
Rabgap1l A C 1: 160,724,036 F263V probably damaging Het
Rnf4 A G 5: 34,351,339 K182E probably damaging Het
Slc24a2 G T 4: 87,011,706 R469S possibly damaging Het
Speer2 A G 16: 69,857,941 probably null Het
Tcrg-C4 G T 13: 19,352,336 R188L unknown Het
Tg C A 15: 66,681,813 probably null Het
Tns1 G A 1: 73,953,820 probably benign Het
Top2b G T 14: 16,409,966 A878S probably benign Het
Ugt3a2 G A 15: 9,361,618 R160Q probably benign Het
Ush2a G T 1: 188,910,808 L4122F probably damaging Het
Other mutations in Krt28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Krt28 APN 11 99371468 missense probably benign 0.00
IGL01568:Krt28 APN 11 99371417 missense probably damaging 1.00
IGL01590:Krt28 APN 11 99374394 critical splice donor site probably null
R1250:Krt28 UTSW 11 99366822 critical splice donor site probably null
R1488:Krt28 UTSW 11 99365171 missense probably benign 0.01
R2116:Krt28 UTSW 11 99365117 missense probably benign 0.27
R4244:Krt28 UTSW 11 99374550 missense probably damaging 1.00
R4862:Krt28 UTSW 11 99365110 missense possibly damaging 0.92
R4928:Krt28 UTSW 11 99374632 missense probably benign 0.00
R5568:Krt28 UTSW 11 99371384 missense probably damaging 1.00
R5642:Krt28 UTSW 11 99374494 missense probably damaging 1.00
R5873:Krt28 UTSW 11 99366890 missense probably damaging 1.00
R6053:Krt28 UTSW 11 99371201 missense probably benign 0.05
R6548:Krt28 UTSW 11 99367013 missense probably damaging 1.00
R7194:Krt28 UTSW 11 99374404 nonsense probably null
R7863:Krt28 UTSW 11 99365173 missense possibly damaging 0.65
R7986:Krt28 UTSW 11 99366825 missense probably benign 0.00
R8415:Krt28 UTSW 11 99374800 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGCAGATTGGGGTCAGG -3'
(R):5'- TGCTAAGTAACTCAGGGCTGG -3'

Sequencing Primer
(F):5'- CAGTGCTTAACATGGATGGTAATG -3'
(R):5'- CTGGGTACTCCTCTGGTGAC -3'
Posted On2017-01-06