Mutagenetix > Incidental Mutation

Incidental Mutation 'R0553:Ltbr'

45281

Institutional Source

Beutler Lab

Gene Symbol

Ltbr

Ensembl Gene

ENSMUSG00000030339

Gene Name

lymphotoxin B receptor

Synonyms

TNF-R-III, TNFRrp, TNFCR, TNFR2-RP, LTbetaR, TNF receptor-related protein, LT-beta receptor, LT beta-R, Tnfbr, Tnfrsf3, Ltar

MMRRC Submission

038745-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0553 (G1)

Quality Score

130

Status

Validated

Chromosome

Chromosomal Location

125306571-125313885 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to C at 125313388 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032489 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032489]

AlphaFold

P50284

Predicted Effect

probably null
Transcript: ENSMUST00000032489

SMART Domains

Protein: ENSMUSP00000032489
Gene: ENSMUSG00000030339

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
TNFR	43	80	5.73e-5	SMART
TNFR	83	124	3.96e-8	SMART
Blast:TNFR	126	169	3e-7	BLAST
TNFR	172	212	1.95e-7	SMART
transmembrane domain	222	244	N/A	INTRINSIC
low complexity region	294	305	N/A	INTRINSIC
low complexity region	362	388	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160901

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161891

Meta Mutation Damage Score

0.9496

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The major ligands of this receptor include lymphotoxin alpha/beta and tumor necrosis factor ligand superfamily member 14. The encoded protein plays a role in signalling during the development of lymphoid and other organs, lipid metabolism, immune response, and programmed cell death. Activity of this receptor has also been linked to carcinogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for a targeted null mutation lack Peyer's patches, colon-associated lymphoid tissues, and lymph nodes. Mutants also exhibit severely reduced numbers of NK cells and increased susceptibility to Theiler's murine encephalomyelitis virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,686	I729V	probably damaging	Het
9530002B09Rik	A	T	4: 122,702,335	M120L	unknown	Het
Adamts13	T	A	2: 26,991,334	C774*	probably null	Het
Amh	A	G	10: 80,806,176		probably benign	Het
Ccdc173	C	A	2: 69,789,441	R8L	probably damaging	Het
Cd40	G	A	2: 165,070,741	R204Q	probably benign	Het
Clhc1	A	C	11: 29,561,366		probably benign	Het
Fbxl17	G	A	17: 63,356,851	R67C	probably damaging	Het
Flg2	A	T	3: 93,203,584	H973L	unknown	Het
Fut2	T	A	7: 45,651,274	I25F	probably damaging	Het
Galnt7	T	C	8: 57,552,430		probably benign	Het
Gm438	T	A	4: 144,777,415	I389L	possibly damaging	Het
Gm7534	T	C	4: 134,202,518	T159A	possibly damaging	Het
Gm8909	G	T	17: 36,168,057	P100Q	probably damaging	Het
Gmppb	A	T	9: 108,049,797	M56L	probably benign	Het
Grm3	C	A	5: 9,570,048	A399S	probably benign	Het
Hey2	G	A	10: 30,840,489		probably benign	Het
Ift172	A	G	5: 31,275,842		probably benign	Het
Kcnh5	C	A	12: 75,137,673	C92F	probably benign	Het
Kdm1a	T	C	4: 136,555,298	D229G	probably damaging	Het
Klf11	C	G	12: 24,655,090	P164R	probably benign	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Krtcap3	T	C	5: 31,251,803	V6A	probably benign	Het
Mmp17	T	G	5: 129,598,670	S298A	probably benign	Het
Nacc2	T	A	2: 26,089,590	E278V	possibly damaging	Het
Olfr175-ps1	A	T	16: 58,824,155	Y185N	probably damaging	Het
Olfr875	T	A	9: 37,773,331	I224N	probably benign	Het
Otop2	C	T	11: 115,329,462	A376V	probably damaging	Het
Pdia2	T	C	17: 26,196,243	E504G	probably damaging	Het
Pdzph1	C	T	17: 58,922,727	V979M	probably damaging	Het
Pou5f1	A	G	17: 35,509,477	K86R	possibly damaging	Het
Ptprq	A	G	10: 107,710,627	F269L	probably benign	Het
Rb1	A	T	14: 73,211,712	C659*	probably null	Het
Rnf8	T	C	17: 29,621,639		probably null	Het
Rras	T	G	7: 45,020,556	I137M	probably benign	Het
Slc38a9	A	T	13: 112,714,198	H372L	probably damaging	Het
Spata9	T	C	13: 75,977,779		probably null	Het
Tas2r115	T	C	6: 132,737,959	T10A	probably benign	Het
Ttn	T	C	2: 76,798,893	E12621G	probably damaging	Het
Unc80	A	T	1: 66,506,669	I460F	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zbtb24	C	T	10: 41,451,997	A293V	possibly damaging	Het

Other mutations in Ltbr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03349:Ltbr	APN	6	125312366	missense	probably damaging	0.96
Armitage	UTSW	6	125312794	missense	probably damaging	0.97
bonsai	UTSW	6	125312770	missense	probably damaging	1.00
kama	UTSW	6	125313388	critical splice donor site	probably null
marine_blue	UTSW	6	125312808	missense	probably damaging	0.98
moksha	UTSW	6	125308068	missense	probably benign	0.00
Questionable	UTSW	6	125313375	splice site	probably benign
R0090:Ltbr	UTSW	6	125309449	splice site	probably benign
R0234:Ltbr	UTSW	6	125312873	missense	probably benign	0.16
R0234:Ltbr	UTSW	6	125312873	missense	probably benign	0.16
R0686:Ltbr	UTSW	6	125308061	missense	possibly damaging	0.88
R0879:Ltbr	UTSW	6	125313375	splice site	probably benign
R1086:Ltbr	UTSW	6	125312740	splice site	probably benign
R2118:Ltbr	UTSW	6	125309477	missense	probably benign	0.34
R2120:Ltbr	UTSW	6	125309477	missense	probably benign	0.34
R2122:Ltbr	UTSW	6	125309477	missense	probably benign	0.34
R2124:Ltbr	UTSW	6	125309477	missense	probably benign	0.34
R2199:Ltbr	UTSW	6	125312061	missense	probably benign	0.25
R4931:Ltbr	UTSW	6	125307474	splice site	probably null
R5051:Ltbr	UTSW	6	125312770	missense	probably damaging	1.00
R5174:Ltbr	UTSW	6	125309537	missense	probably benign	0.00
R5268:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5269:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5357:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5358:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5360:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5361:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5363:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5434:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5436:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5441:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5442:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5533:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5534:Ltbr	UTSW	6	125312794	missense	probably damaging	0.97
R5859:Ltbr	UTSW	6	125312808	missense	probably damaging	0.98
R6217:Ltbr	UTSW	6	125307454	missense	probably damaging	1.00
R6702:Ltbr	UTSW	6	125308068	missense	probably benign	0.00
R7101:Ltbr	UTSW	6	125312800	missense	probably benign	0.00
R7584:Ltbr	UTSW	6	125307241	missense	probably benign	0.09
R7587:Ltbr	UTSW	6	125312352	missense	probably benign
R8798:Ltbr	UTSW	6	125307295	missense	probably benign	0.01
R9720:Ltbr	UTSW	6	125307385	missense	probably damaging	1.00
R9721:Ltbr	UTSW	6	125307385	missense	probably damaging	1.00
R9723:Ltbr	UTSW	6	125307385	missense	probably damaging	1.00
R9746:Ltbr	UTSW	6	125313101	missense	probably benign
R9750:Ltbr	UTSW	6	125307385	missense	probably damaging	1.00
R9753:Ltbr	UTSW	6	125307385	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGTCCCCACTTACCAATGTCACAG -3'
(R):5'- ATGGACCAGGTTTCTCTCTAGCCC -3'

Sequencing Primer
(F):5'- GCAAGTCTTGCAAACCGTG -3'
(R):5'- CTTCTGCCCTCCAGAGCTG -3'

Posted On

2013-06-11