Mutagenetix > Incidental Mutation

Incidental Mutation 'R5094:Cdh18'

452816

Institutional Source

Beutler Lab

Gene Symbol

Cdh18

Ensembl Gene

ENSMUSG00000040420

Gene Name

cadherin 18

Synonyms

MMRRC Submission

042683-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.079) question?

Stock #

R5094 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

22549022-23474418 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 22714539 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163361]

AlphaFold

E9Q9Q6

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000022493

Predicted Effect

probably benign
Transcript: ENSMUST00000163361

SMART Domains

Protein: ENSMUSP00000129170
Gene: ENSMUSG00000040420

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
CA	76	157	4.24e-14	SMART
CA	181	266	1.37e-31	SMART
Pfam:Cadherin	273	337	2.8e-11	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.9%

Validation Efficiency

91% (40/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is expressed specifically in the central nervous system and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	G	T	15: 82,062,682	G260V	possibly damaging	Het
Agap3	T	C	5: 24,451,321		probably benign	Het
Bicra	A	G	7: 15,975,371	S1173P	probably damaging	Het
C3	A	T	17: 57,225,033		probably null	Het
Cep290	A	G	10: 100,567,030	K2274E	probably damaging	Het
Cfap54	T	C	10: 92,898,999		probably benign	Het
Chat	T	A	14: 32,408,939	I582F	probably damaging	Het
Chrnb4	T	C	9: 55,035,313	I226V	probably benign	Het
Dnajc2	T	C	5: 21,776,732	T139A	probably damaging	Het
Eml1	T	C	12: 108,536,311	F712S	probably benign	Het
Fgfr1	C	T	8: 25,570,165	S524L	probably damaging	Het
Gimap3	T	C	6: 48,765,372	E208G	probably damaging	Het
Gm12185	T	A	11: 48,907,548	D706V	probably benign	Het
Gucy1a2	T	A	9: 3,865,443	V639D	probably damaging	Het
Hivep2	T	C	10: 14,132,149	F1497S	probably benign	Het
Hunk	A	G	16: 90,496,666	D612G	probably benign	Het
Ifit3b	T	A	19: 34,612,548	S375T	possibly damaging	Het
Mucl1	A	G	15: 103,755,403	S13P	possibly damaging	Het
Olfr1051	T	A	2: 86,276,040	Y149F	probably damaging	Het
Olfr1135	C	T	2: 87,671,830	C179Y	possibly damaging	Het
Pah	T	A	10: 87,538,219	Y78*	probably null	Het
Pex13	A	G	11: 23,655,441	V263A	probably benign	Het
Pfdn2	T	A	1: 171,356,499		probably benign	Het
Phip	C	T	9: 82,871,844	V1616I	probably benign	Het
Pigg	A	G	5: 108,336,257	S457G	possibly damaging	Het
Ppp1r13b	A	G	12: 111,843,610	S97P	probably benign	Het
Slc22a6	T	C	19: 8,626,177	L535P	probably damaging	Het
Slc5a1	A	G	5: 33,158,280	T548A	probably damaging	Het
Smtnl2	T	A	11: 72,400,385	S346C	probably damaging	Het
Spata31d1a	A	G	13: 59,705,044		probably null	Het
Tlcd2	T	C	11: 75,469,814	S228P	probably benign	Het
Tmem135	A	G	7: 89,143,793	L411P	probably damaging	Het
Tnrc6c	T	C	11: 117,721,046	V170A	probably benign	Het

Other mutations in Cdh18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00973:Cdh18	APN	15	23173796	missense	probably damaging	0.97
IGL01663:Cdh18	APN	15	23445991	missense	possibly damaging	0.92
IGL01758:Cdh18	APN	15	23474183	missense	probably benign	0.20
IGL02192:Cdh18	APN	15	23460316	missense	probably damaging	1.00
IGL02448:Cdh18	APN	15	23173789	missense	probably benign	0.00
IGL02717:Cdh18	APN	15	23410715	nonsense	probably null
IGL03241:Cdh18	APN	15	23226933	missense	probably benign	0.19
IGL03268:Cdh18	APN	15	23366867	missense	probably damaging	1.00
IGL03307:Cdh18	APN	15	23226786	missense	probably damaging	1.00
R0316:Cdh18	UTSW	15	23366913	missense	probably damaging	1.00
R0462:Cdh18	UTSW	15	23366885	missense	probably damaging	1.00
R0607:Cdh18	UTSW	15	23410790	missense	probably benign	0.01
R0761:Cdh18	UTSW	15	23226752	missense	possibly damaging	0.87
R0973:Cdh18	UTSW	15	23473995	missense	probably damaging	0.99
R1110:Cdh18	UTSW	15	23474317	missense	probably benign	0.00
R1550:Cdh18	UTSW	15	23436548	missense	probably damaging	1.00
R1656:Cdh18	UTSW	15	23474399	missense	probably benign	0.38
R1682:Cdh18	UTSW	15	23400585	missense	probably benign	0.05
R1770:Cdh18	UTSW	15	23474401	missense	probably benign
R1829:Cdh18	UTSW	15	23173852	missense	probably damaging	1.00
R2253:Cdh18	UTSW	15	23410805	missense	probably benign	0.00
R2435:Cdh18	UTSW	15	23367008	missense	probably damaging	1.00
R3914:Cdh18	UTSW	15	23410685	missense	probably damaging	1.00
R3964:Cdh18	UTSW	15	23474101	missense	probably benign
R4002:Cdh18	UTSW	15	23382962	missense	possibly damaging	0.48
R4291:Cdh18	UTSW	15	22714551	intron	probably benign
R4581:Cdh18	UTSW	15	23226783	missense	probably damaging	1.00
R4604:Cdh18	UTSW	15	23474368	missense	probably benign	0.05
R4625:Cdh18	UTSW	15	22714042	intron	probably benign
R4786:Cdh18	UTSW	15	23410787	missense	probably null	1.00
R4811:Cdh18	UTSW	15	23226791	missense	probably benign	0.30
R5023:Cdh18	UTSW	15	23259666	missense	probably damaging	1.00
R5278:Cdh18	UTSW	15	23474158	missense	probably benign	0.04
R5416:Cdh18	UTSW	15	23226723	missense	probably damaging	1.00
R5503:Cdh18	UTSW	15	23436534	missense	probably damaging	0.96
R5617:Cdh18	UTSW	15	23226768	missense	probably damaging	0.97
R5982:Cdh18	UTSW	15	23474216	missense	possibly damaging	0.89
R6240:Cdh18	UTSW	15	23226936	missense	possibly damaging	0.82
R6475:Cdh18	UTSW	15	23226936	missense	possibly damaging	0.82
R6649:Cdh18	UTSW	15	23436534	missense	possibly damaging	0.87
R6700:Cdh18	UTSW	15	23474105	missense	probably benign
R6718:Cdh18	UTSW	15	23226749	missense	probably benign	0.15
R6796:Cdh18	UTSW	15	23446073	missense	probably damaging	1.00
R7330:Cdh18	UTSW	15	23226950	missense	possibly damaging	0.46
R7429:Cdh18	UTSW	15	23366856	missense	possibly damaging	0.89
R7477:Cdh18	UTSW	15	23410725	missense	probably benign
R7516:Cdh18	UTSW	15	23259598	splice site	probably null
R7519:Cdh18	UTSW	15	23474212	missense	possibly damaging	0.68
R7575:Cdh18	UTSW	15	23400597	nonsense	probably null
R7618:Cdh18	UTSW	15	23366970	missense	probably damaging	1.00
R7844:Cdh18	UTSW	15	23410787	missense	probably damaging	1.00
R7870:Cdh18	UTSW	15	23474327	missense	possibly damaging	0.94
R8288:Cdh18	UTSW	15	23445987	missense	probably damaging	1.00
R8420:Cdh18	UTSW	15	23474052	missense	possibly damaging	0.94
R8430:Cdh18	UTSW	15	23226684	missense	probably damaging	1.00
R8916:Cdh18	UTSW	15	23410727	missense	probably damaging	0.99
R9093:Cdh18	UTSW	15	23473978	missense	probably damaging	1.00
R9183:Cdh18	UTSW	15	23226979	critical splice donor site	probably null
R9399:Cdh18	UTSW	15	23173813	missense	probably damaging	1.00
R9531:Cdh18	UTSW	15	23436476	missense	probably benign
Z1189:Cdh18	UTSW	15	23474283	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AATCGTATCCACAGAGTCATGG -3'
(R):5'- GTCTGAGGAGCCATTTTGAGC -3'

Sequencing Primer
(F):5'- GTATCCACAGAGTCATGGTCATC -3'
(R):5'- TTTTGAGCAATGGGGAACACTAACC -3'

Posted On

2017-01-10