Incidental Mutation 'R0553:Tas2r115'
ID 45282
Institutional Source Beutler Lab
Gene Symbol Tas2r115
Ensembl Gene ENSMUSG00000071149
Gene Name taste receptor, type 2, member 115
Synonyms mGR15, T2R15, Tas2r15, mt2r49
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 132737003-132738035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132737959 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 10 (T10A)
Ref Sequence ENSEMBL: ENSMUSP00000093043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095394]
AlphaFold Q7M719
Predicted Effect probably benign
Transcript: ENSMUST00000095394
AA Change: T10A

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093043
Gene: ENSMUSG00000071149
AA Change: T10A

DomainStartEndE-ValueType
Pfam:TAS2R 1 299 2.2e-84 PFAM
Meta Mutation Damage Score 0.2581 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Tas2r115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Tas2r115 APN 6 132737778 missense probably benign 0.11
IGL01285:Tas2r115 APN 6 132737678 missense probably damaging 1.00
IGL01516:Tas2r115 APN 6 132737613 missense probably damaging 0.98
IGL01637:Tas2r115 APN 6 132737629 missense probably damaging 0.99
IGL02041:Tas2r115 APN 6 132737467 missense probably benign 0.13
IGL02178:Tas2r115 APN 6 132737308 missense probably benign 0.11
R0467:Tas2r115 UTSW 6 132737719 missense probably benign 0.02
R1425:Tas2r115 UTSW 6 132737479 missense probably benign 0.02
R1770:Tas2r115 UTSW 6 132737971 missense probably damaging 1.00
R2120:Tas2r115 UTSW 6 132737507 missense possibly damaging 0.51
R2136:Tas2r115 UTSW 6 132737346 missense probably damaging 0.99
R2141:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R2142:Tas2r115 UTSW 6 132737358 missense probably benign 0.43
R4479:Tas2r115 UTSW 6 132737532 missense probably damaging 0.98
R4687:Tas2r115 UTSW 6 132737284 missense possibly damaging 0.80
R4948:Tas2r115 UTSW 6 132737161 missense probably damaging 1.00
R5097:Tas2r115 UTSW 6 132737253 missense probably damaging 1.00
R5856:Tas2r115 UTSW 6 132737538 missense possibly damaging 0.86
R6927:Tas2r115 UTSW 6 132737932 missense probably damaging 1.00
R7473:Tas2r115 UTSW 6 132737251 missense probably damaging 1.00
R7688:Tas2r115 UTSW 6 132737680 missense probably damaging 1.00
R8415:Tas2r115 UTSW 6 132737835 missense probably damaging 1.00
R8495:Tas2r115 UTSW 6 132737924 missense probably damaging 1.00
R9032:Tas2r115 UTSW 6 132737364 missense probably benign 0.37
R9085:Tas2r115 UTSW 6 132737364 missense probably benign 0.37
R9318:Tas2r115 UTSW 6 132737509 missense probably benign 0.01
Z1088:Tas2r115 UTSW 6 132737081 nonsense probably null
Z1176:Tas2r115 UTSW 6 132737856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATCAGAGCAAGCCTGGAGATGG -3'
(R):5'- TCAAGTTTACCTGCACAGACAAGGG -3'

Sequencing Primer
(F):5'- GCCAGAGCAGTGAGGAAATG -3'
(R):5'- TGCACAGAACCTGGAAGAATTTC -3'
Posted On 2013-06-11