Mutagenetix > Incidental Mutation

Incidental Mutation 'R5120:Grik5'

452824

Institutional Source

Beutler Lab

Gene Symbol

Grik5

Ensembl Gene

ENSMUSG00000003378

Gene Name

glutamate receptor, ionotropic, kainate 5 (gamma 2)

Synonyms

GluRgamma2, KA2

MMRRC Submission

042708-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

R5120 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

25009849-25072346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25010640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 890 (L890P)

Ref Sequence

ENSEMBL: ENSMUSP00000003468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000080882] [ENSMUST00000102858] [ENSMUST00000196684] [ENSMUST00000205328] [ENSMUST00000206134]

AlphaFold

Q61626

Predicted Effect

probably damaging
Transcript: ENSMUST00000003468
AA Change: L890P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: L890P

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	40	381	3.4e-64	PFAM
PBPe	416	785	3.7e-122	SMART
Lig_chan-Glu_bd	426	490	1.65e-29	SMART
transmembrane domain	804	823	N/A	INTRINSIC
low complexity region	859	872	N/A	INTRINSIC
low complexity region	893	921	N/A	INTRINSIC
low complexity region	962	973	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000080882

SMART Domains

Protein: ENSMUSP00000079691
Gene: ENSMUSG00000040907

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
Cation_ATPase_N	32	106	2.41e-22	SMART
Pfam:E1-E2_ATPase	125	356	6.3e-64	PFAM
Pfam:Hydrolase	360	719	2.6e-32	PFAM
Pfam:HAD	363	716	4.7e-18	PFAM
Pfam:Hydrolase_like2	416	511	5.7e-26	PFAM
Pfam:Cation_ATPase_C	789	998	3.5e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102858

SMART Domains

Protein: ENSMUSP00000099922
Gene: ENSMUSG00000040907

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
Cation_ATPase_N	32	106	2.41e-22	SMART
Pfam:E1-E2_ATPase	124	355	4.6e-60	PFAM
Pfam:Hydrolase	360	719	5.7e-20	PFAM
Pfam:HAD	363	716	4.5e-19	PFAM
Pfam:Cation_ATPase	416	511	5.1e-25	PFAM
Pfam:Cation_ATPase_C	789	998	1.4e-46	PFAM
low complexity region	1030	1047	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146595

Predicted Effect

probably benign
Transcript: ENSMUST00000196684

SMART Domains

Protein: ENSMUSP00000143735
Gene: ENSMUSG00000040907

Domain	Start	End	E-Value	Type
low complexity region	16	30	N/A	INTRINSIC
Cation_ATPase_N	45	119	1.9e-26	SMART
Pfam:E1-E2_ATPase	137	368	4e-58	PFAM
Pfam:Hydrolase	373	732	3.8e-18	PFAM
Pfam:HAD	376	729	3.8e-17	PFAM
Pfam:Cation_ATPase	429	524	5.2e-23	PFAM
Pfam:Cation_ATPase_C	802	1011	2.5e-44	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205328

Predicted Effect

probably benign
Transcript: ENSMUST00000206134

Meta Mutation Damage Score

0.1326

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 95.8%
20x: 90.6%

Validation Efficiency

100% (97/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,210,235	H225R	probably benign	Het
Abcc9	T	A	6: 142,656,618	I690F	probably benign	Het
Acp4	A	T	7: 44,256,971	D52E	probably damaging	Het
Adam17	T	C	12: 21,343,019		probably benign	Het
Adamts15	T	C	9: 30,921,576	E221G	probably damaging	Het
Aoc2	A	G	11: 101,325,714	T208A	probably benign	Het
Apoa4	T	G	9: 46,242,737	I212S	probably damaging	Het
Bptf	A	T	11: 107,073,385	M1598K	probably damaging	Het
Camsap3	G	A	8: 3,600,680	R209Q	probably damaging	Het
Ccdc171	C	A	4: 83,558,526		probably benign	Het
Celsr2	G	C	3: 108,393,120	P2875A	probably benign	Het
Cenpb	A	G	2: 131,179,818	V20A	probably benign	Het
Cfap61	A	T	2: 146,143,160	K975*	probably null	Het
Col9a2	G	T	4: 121,039,772	A20S	unknown	Het
Crnn	A	T	3: 93,148,896	I330F	probably benign	Het
Csf3r	C	A	4: 126,035,827	P381Q	probably benign	Het
Csmd3	G	A	15: 48,673,495	Q104*	probably null	Het
Ctnna1	G	A	18: 35,182,554		probably null	Het
Cwf19l2	C	T	9: 3,418,761	Q183*	probably null	Het
Ddx60	T	C	8: 61,945,906	Y220H	probably benign	Het
Dhh	T	C	15: 98,898,157	Q39R	probably benign	Het
Dynlrb2	T	A	8: 116,515,698	I89N	possibly damaging	Het
Dytn	T	C	1: 63,623,043	E645G	probably benign	Het
Efcab7	A	G	4: 99,897,491	T287A	probably damaging	Het
Eogt	A	G	6: 97,134,315	V195A	probably benign	Het
Ep400	G	T	5: 110,756,358	P125Q	probably damaging	Het
Fasn	A	G	11: 120,811,391	V1815A	probably benign	Het
Gm4788	T	C	1: 139,753,103	S226G	probably benign	Het
Gm5866	T	C	5: 52,582,882		noncoding transcript	Het
Gm8674	C	A	13: 49,901,948		noncoding transcript	Het
Gpat4	G	T	8: 23,180,202	H270Q	possibly damaging	Het
Gsap	A	G	5: 21,269,936	N500S	probably damaging	Het
H2-M10.1	T	C	17: 36,325,156	D173G	probably benign	Het
Igfn1	T	A	1: 135,973,502	I413F	possibly damaging	Het
Ighv1-52	G	T	12: 115,145,786	H17N	probably benign	Het
Kcnu1	T	A	8: 25,934,488	D270E	possibly damaging	Het
Kif16b	A	C	2: 142,848,339	N274K	probably damaging	Het
Klk1b11	C	T	7: 43,999,022	T151I	probably benign	Het
Krtap13	A	G	16: 88,751,570	F10S	probably damaging	Het
Large1	A	T	8: 72,859,341	I379N	probably damaging	Het
Lhx8	T	C	3: 154,311,695	H301R	probably damaging	Het
Lrriq3	T	C	3: 155,129,384	V252A	probably benign	Het
Lysmd3	T	A	13: 81,669,192	I96N	probably damaging	Het
Mpeg1	C	T	19: 12,461,429	Q84*	probably null	Het
Myoz1	C	T	14: 20,650,654	G165D	probably benign	Het
Myt1	G	A	2: 181,797,620	V312I	probably benign	Het
Ndufb7	T	C	8: 83,566,977		probably benign	Het
Numa1	C	T	7: 101,977,437	T10M	probably damaging	Het
Olfr1285	T	C	2: 111,409,240		noncoding transcript	Het
Olfr130	A	T	17: 38,067,266	I32F	probably damaging	Het
Olfr1316	A	T	2: 112,130,558	D84E	probably damaging	Het
Olfr149	T	A	9: 39,702,070	H233L	probably benign	Het
Olfr390	A	C	11: 73,786,964	I9L	probably benign	Het
Osmr	A	T	15: 6,827,275	S464T	probably benign	Het
Pak7	G	A	2: 136,083,229	H718Y	probably damaging	Het
Pan2	T	A	10: 128,314,995		probably null	Het
Pik3r4	T	C	9: 105,669,009	S853P	probably benign	Het
Pnkp	C	T	7: 44,862,403	S113L	probably damaging	Het
Polr3gl	T	A	3: 96,578,479		probably benign	Het
Psd2	G	A	18: 35,979,810	R186Q	possibly damaging	Het
Psd4	T	C	2: 24,405,438	V868A	probably benign	Het
Ralgapa2	G	T	2: 146,412,084	T852K	probably benign	Het
Rbm43	T	C	2: 51,932,423		probably benign	Het
Rps6kl1	C	A	12: 85,139,348	G329C	probably damaging	Het
Scaf11	T	C	15: 96,419,542	T714A	probably benign	Het
Selenoo	C	A	15: 89,094,305	N310K	possibly damaging	Het
Sepsecs	T	C	5: 52,660,661	Q258R	probably damaging	Het
Sgcz	T	C	8: 37,526,266	S226G	probably benign	Het
Slfn5	A	G	11: 82,960,928	K627E	probably damaging	Het
Sos1	A	T	17: 80,408,248	F1027I	probably damaging	Het
Ssh1	C	G	5: 113,957,398	V228L	possibly damaging	Het
Sugp1	C	A	8: 70,048,667	P65T	probably benign	Het
Tas2r106	T	A	6: 131,678,816	N24I	probably damaging	Het
Tex10	T	C	4: 48,459,272	E534G	possibly damaging	Het
Tmem182	C	T	1: 40,854,901	T192I	possibly damaging	Het
Traf7	T	A	17: 24,518,744	K51*	probably null	Het
Trap1	C	A	16: 4,044,088	R604L	probably damaging	Het
Trim6	T	A	7: 104,228,240	L179Q	probably damaging	Het
Ubfd1	T	C	7: 122,071,750	S264P	probably damaging	Het
Upk3bl	T	C	5: 136,064,191		probably benign	Het
Wdfy3	T	A	5: 101,868,106	Q2601L	possibly damaging	Het
Wdr89	A	G	12: 75,632,638	Y281H	probably damaging	Het
Zfp286	A	T	11: 62,780,725	M174K	probably benign	Het
Zmym1	T	C	4: 127,051,437		probably null	Het

Other mutations in Grik5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Grik5	APN	7	25065393	missense	probably damaging	1.00
IGL00974:Grik5	APN	7	25013885	missense	probably damaging	1.00
IGL01941:Grik5	APN	7	25065182	missense	probably damaging	1.00
IGL02642:Grik5	APN	7	25058983	missense	possibly damaging	0.51
IGL03177:Grik5	APN	7	25015454	missense	probably damaging	1.00
IGL03402:Grik5	APN	7	25015469	missense	probably damaging	1.00
Griffin	UTSW	7	25059077	missense	possibly damaging	0.78
G1citation:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
PIT4453001:Grik5	UTSW	7	25010694	missense	probably damaging	0.99
R0077:Grik5	UTSW	7	25023380	missense	probably damaging	1.00
R0412:Grik5	UTSW	7	25013674	missense	possibly damaging	0.59
R0427:Grik5	UTSW	7	25058498	missense	probably benign	0.34
R1191:Grik5	UTSW	7	25058325	nonsense	probably null
R1830:Grik5	UTSW	7	25046301	missense	possibly damaging	0.94
R2072:Grik5	UTSW	7	25015313	missense	possibly damaging	0.92
R2369:Grik5	UTSW	7	25058537	missense	probably damaging	1.00
R3410:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3411:Grik5	UTSW	7	25062972	missense	probably benign	0.04
R3615:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R3616:Grik5	UTSW	7	25022571	missense	probably benign	0.37
R4600:Grik5	UTSW	7	25068064	missense	probably damaging	0.99
R4658:Grik5	UTSW	7	25060727	splice site	probably benign
R4735:Grik5	UTSW	7	25058288	missense	probably damaging	1.00
R4810:Grik5	UTSW	7	25015497	missense	probably damaging	0.98
R5113:Grik5	UTSW	7	25015527	missense	probably damaging	1.00
R5132:Grik5	UTSW	7	25065204	missense	probably benign	0.02
R5173:Grik5	UTSW	7	25062894	missense	possibly damaging	0.76
R5186:Grik5	UTSW	7	25015819	missense	probably damaging	1.00
R5239:Grik5	UTSW	7	25065470	missense	probably damaging	1.00
R5935:Grik5	UTSW	7	25059077	missense	possibly damaging	0.78
R6335:Grik5	UTSW	7	25013594	missense	probably benign
R6609:Grik5	UTSW	7	25015526	nonsense	probably null
R6760:Grik5	UTSW	7	25058939	critical splice donor site	probably null
R6820:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6821:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6822:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R6824:Grik5	UTSW	7	25046355	missense	possibly damaging	0.46
R7173:Grik5	UTSW	7	25068162	missense	probably damaging	1.00
R7230:Grik5	UTSW	7	25023070	missense	probably damaging	1.00
R7555:Grik5	UTSW	7	25060597	missense	probably benign
R7560:Grik5	UTSW	7	25058526	missense	probably damaging	0.99
R7571:Grik5	UTSW	7	25013885	missense	possibly damaging	0.87
R8228:Grik5	UTSW	7	25010508	missense	probably damaging	1.00
R8228:Grik5	UTSW	7	25046310	missense	possibly damaging	0.93
R8681:Grik5	UTSW	7	25010472	missense	probably benign	0.06
R8879:Grik5	UTSW	7	25023064	missense	possibly damaging	0.95
R8933:Grik5	UTSW	7	25023318	missense	probably benign	0.11
R9129:Grik5	UTSW	7	25068004	splice site	probably benign
R9130:Grik5	UTSW	7	25068004	splice site	probably benign
R9154:Grik5	UTSW	7	25058978	missense	probably damaging	1.00
R9317:Grik5	UTSW	7	25046235	missense	probably damaging	0.99
R9355:Grik5	UTSW	7	25068172	missense	possibly damaging	0.82
R9406:Grik5	UTSW	7	25058544	missense	probably benign	0.00
X0017:Grik5	UTSW	7	25060588	missense	probably damaging	1.00
Z1176:Grik5	UTSW	7	25013804	missense	probably damaging	0.98
Z1177:Grik5	UTSW	7	25015825	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGAAGGCAAAATCGCGGC -3'
(R):5'- ATGGCAGTCAGAGCATCTTG -3'

Sequencing Primer
(F):5'- AAAATCGCGGCGTCCTGTC -3'
(R):5'- GTCAGAGCATCTTGTTTGGAAAGAC -3'

Posted On

2017-01-11