Incidental Mutation 'R0553:Rras'
ID 45283
Institutional Source Beutler Lab
Gene Symbol Rras
Ensembl Gene ENSMUSG00000038387
Gene Name related RAS viral (r-ras) oncogene
Synonyms
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45017961-45021647 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 45020556 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 137 (I137M)
Ref Sequence ENSEMBL: ENSMUSP00000042150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044111] [ENSMUST00000085383] [ENSMUST00000210895] [ENSMUST00000211680]
AlphaFold P10833
Predicted Effect probably benign
Transcript: ENSMUST00000044111
AA Change: I137M

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000042150
Gene: ENSMUSG00000038387
AA Change: I137M

DomainStartEndE-ValueType
RAS 27 193 2.25e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085383
SMART Domains Protein: ENSMUSP00000082501
Gene: ENSMUSG00000038406

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
low complexity region 185 224 N/A INTRINSIC
coiled coil region 269 295 N/A INTRINSIC
low complexity region 367 379 N/A INTRINSIC
low complexity region 382 396 N/A INTRINSIC
low complexity region 411 435 N/A INTRINSIC
low complexity region 488 511 N/A INTRINSIC
low complexity region 534 618 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
low complexity region 703 726 N/A INTRINSIC
low complexity region 730 739 N/A INTRINSIC
low complexity region 752 775 N/A INTRINSIC
Blast:IG_like 776 833 6e-6 BLAST
low complexity region 843 873 N/A INTRINSIC
low complexity region 876 888 N/A INTRINSIC
low complexity region 917 937 N/A INTRINSIC
coiled coil region 963 983 N/A INTRINSIC
low complexity region 1025 1037 N/A INTRINSIC
low complexity region 1098 1128 N/A INTRINSIC
low complexity region 1136 1146 N/A INTRINSIC
Blast:IG_like 1151 1194 2e-16 BLAST
low complexity region 1225 1256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210056
Predicted Effect probably benign
Transcript: ENSMUST00000210397
Predicted Effect probably benign
Transcript: ENSMUST00000210895
Predicted Effect probably benign
Transcript: ENSMUST00000211680
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a small GTPase involved in diverse processes including angiogenesis, vascular homeostasis and regeneration, cell adhesion, and neuronal axon guidance. Mutations in this gene are found in many invasive cancers. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit enhanced neointimal thickening in response to arterial injury, increased angiogenesis in matrigel plugs and aortic ring cultures, and increased neovascularization of tumor implants, and decreased B-cell and increased T-cell population percentages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Rras
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rras APN 7 45021285 missense possibly damaging 0.89
R1297:Rras UTSW 7 45020579 missense probably damaging 1.00
R2495:Rras UTSW 7 45018064 missense probably damaging 1.00
R4419:Rras UTSW 7 45020579 missense probably damaging 1.00
R5833:Rras UTSW 7 45021291 missense possibly damaging 0.72
R6042:Rras UTSW 7 45020396 missense probably damaging 0.97
R6291:Rras UTSW 7 45018171 splice site probably null
R7542:Rras UTSW 7 45020342 missense probably damaging 1.00
R7782:Rras UTSW 7 45021105 missense probably benign 0.33
R9411:Rras UTSW 7 45020555
Predicted Primers PCR Primer
(F):5'- TTGCCATTAACGACAGGCAGAGG -3'
(R):5'- TCAGGACAGGGGAACCAGTATCAAC -3'

Sequencing Primer
(F):5'- AGGTGAGGGGGATGCTG -3'
(R):5'- tggttagaatccctcagtgatg -3'
Posted On 2013-06-11