Incidental Mutation 'R5111:Mdm2'
ID452831
Institutional Source Beutler Lab
Gene Symbol Mdm2
Ensembl Gene ENSMUSG00000020184
Gene Nametransformed mouse 3T3 cell double minute 2
SynonymsMdm-2, 1700007J15Rik
MMRRC Submission 042699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5111 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location117688875-117710758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 117691221 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 273 (V273D)
Ref Sequence ENSEMBL: ENSMUSP00000020408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020399] [ENSMUST00000020408] [ENSMUST00000105263] [ENSMUST00000155285]
Predicted Effect probably benign
Transcript: ENSMUST00000020399
SMART Domains Protein: ENSMUSP00000020399
Gene: ENSMUSG00000020183

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Zn_pept 22 406 2.03e-45 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000020408
AA Change: V273D

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020408
Gene: ENSMUSG00000020184
AA Change: V273D

DomainStartEndE-ValueType
Pfam:SWIB 26 101 1.3e-11 PFAM
low complexity region 145 166 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 248 262 N/A INTRINSIC
Pfam:zf-RanBP 297 326 1.7e-10 PFAM
low complexity region 390 410 N/A INTRINSIC
RING 436 476 2.42e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105263
AA Change: V224D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000100898
Gene: ENSMUSG00000020184
AA Change: V224D

DomainStartEndE-ValueType
Pfam:SWIB 1 53 5e-15 PFAM
low complexity region 96 117 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
Pfam:zf-RanBP 248 277 5.7e-10 PFAM
low complexity region 341 361 N/A INTRINSIC
RING 387 427 2.42e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137102
Predicted Effect probably benign
Transcript: ENSMUST00000155285
SMART Domains Protein: ENSMUSP00000137039
Gene: ENSMUSG00000020184

DomainStartEndE-ValueType
Pfam:SWIB 27 102 3.1e-22 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality. Mice homozygous for a null allele exhibit prenatal lethality. Mice homozygous for one knock-in allele exhibit embryonic lethality while mice homozygous for a different knock-in allele exhibit alters cell cycle regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17c A T 7: 84,151,438 L136* probably null Het
Ankrd17 A T 5: 90,242,999 S2271T possibly damaging Het
Arhgef10 A G 8: 14,932,408 D179G probably benign Het
Bcan G T 3: 87,994,207 S396Y probably damaging Het
Btbd3 T A 2: 138,278,909 M1K probably null Het
Capns1 A G 7: 30,192,519 V106A probably benign Het
Ccnjl A G 11: 43,556,717 T76A probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Col6a6 C T 9: 105,709,474 V1783I possibly damaging Het
Crisp3 T C 17: 40,225,804 T207A possibly damaging Het
Crxos G A 7: 15,896,217 probably benign Het
Csf3r T C 4: 126,030,068 probably null Het
Cyp2a12 A G 7: 27,036,621 Y485C possibly damaging Het
Echdc2 A T 4: 108,169,797 probably benign Het
Elp3 A C 14: 65,560,236 Y329D probably damaging Het
Fbxw16 T C 9: 109,436,728 D341G probably benign Het
H2-Ab1 T A 17: 34,267,482 S172T probably damaging Het
Hyal2 T C 9: 107,571,111 V321A probably benign Het
Ighv6-3 A T 12: 114,391,774 S98R probably benign Het
Kank3 A G 17: 33,818,181 E153G possibly damaging Het
Klrb1c C T 6: 128,786,005 R83H probably benign Het
Krtap16-1 T C 11: 99,986,552 K9E possibly damaging Het
Liph G A 16: 21,984,070 S83F probably damaging Het
Lnpep A G 17: 17,578,610 I261T possibly damaging Het
Mterf1a A G 5: 3,891,860 S3P probably benign Het
Myt1 A G 2: 181,795,885 T172A probably benign Het
Nufip2 T A 11: 77,691,843 S194R probably benign Het
Nusap1 T A 2: 119,630,356 L110* probably null Het
Palb2 A T 7: 122,117,305 C488* probably null Het
Pcdhac1 A T 18: 37,091,505 N457I probably damaging Het
Per1 A T 11: 69,100,786 S49C probably damaging Het
Ppargc1b A T 18: 61,310,487 I535N probably damaging Het
Rb1cc1 T C 1: 6,214,634 probably benign Het
Rpap1 A T 2: 119,771,247 L744Q probably damaging Het
Sdk1 A G 5: 142,127,845 E1549G probably damaging Het
Tnr C T 1: 159,886,228 T742I probably benign Het
Trp53bp1 A T 2: 121,211,387 H1229Q probably damaging Het
Unc80 A G 1: 66,527,995 H920R possibly damaging Het
Urb1 A C 16: 90,752,017 S2268A probably benign Het
Usp32 A T 11: 85,077,331 Y169N possibly damaging Het
Vmn2r18 A T 5: 151,562,448 M527K possibly damaging Het
Vmn2r93 A T 17: 18,326,064 I733F probably damaging Het
Vstm2l A G 2: 157,935,469 D89G probably damaging Het
Zdhhc8 G T 16: 18,226,748 Q303K probably benign Het
Zfand2a A G 5: 139,473,754 V159A probably benign Het
Zswim6 A G 13: 107,728,635 noncoding transcript Het
Other mutations in Mdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Mdm2 APN 10 117702299 missense possibly damaging 0.91
IGL02102:Mdm2 APN 10 117692717 missense possibly damaging 0.93
Xi-an UTSW 10 117709789 splice site probably null
PIT1430001:Mdm2 UTSW 10 117694935 missense probably damaging 1.00
R0322:Mdm2 UTSW 10 117702204 missense possibly damaging 0.78
R1589:Mdm2 UTSW 10 117690529 missense probably benign 0.01
R1766:Mdm2 UTSW 10 117696022 missense probably damaging 1.00
R3153:Mdm2 UTSW 10 117709713 missense possibly damaging 0.90
R4384:Mdm2 UTSW 10 117696439 missense possibly damaging 0.67
R4411:Mdm2 UTSW 10 117709789 splice site probably null
R5509:Mdm2 UTSW 10 117690612 missense probably damaging 1.00
R5578:Mdm2 UTSW 10 117702287 missense possibly damaging 0.81
R5727:Mdm2 UTSW 10 117702307 missense possibly damaging 0.77
R6382:Mdm2 UTSW 10 117692721 missense probably benign 0.31
R7506:Mdm2 UTSW 10 117690691 missense possibly damaging 0.94
R8363:Mdm2 UTSW 10 117690334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTATATGAAATAGTGACAGGCTAG -3'
(R):5'- CTAACAACTCTTGCCATTGCG -3'

Sequencing Primer
(F):5'- CAGGCTAGAGATGGCTCAGGTTC -3'
(R):5'- CCATTGCGAGTAAAGGTTTTCC -3'
Posted On2017-01-11