Incidental Mutation 'R5128:Dgkz'
ID452839
Institutional Source Beutler Lab
Gene Symbol Dgkz
Ensembl Gene ENSMUSG00000040479
Gene Namediacylglycerol kinase zeta
SynonymsE130307B02Rik, mDGK[z]
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location91932824-91975864 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91942683 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 343 (I343T)
Ref Sequence ENSEMBL: ENSMUSP00000106934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028667] [ENSMUST00000099709] [ENSMUST00000111303] [ENSMUST00000128152] [ENSMUST00000142090] [ENSMUST00000142231] [ENSMUST00000178895]
Predicted Effect probably damaging
Transcript: ENSMUST00000028667
AA Change: I149T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028667
Gene: ENSMUSG00000040479
AA Change: I149T

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
C1 96 153 2.67e-1 SMART
C1 173 231 8.18e-7 SMART
low complexity region 257 274 N/A INTRINSIC
DAGKc 296 420 4.61e-65 SMART
DAGKa 447 604 2.75e-95 SMART
low complexity region 762 780 N/A INTRINSIC
ANK 823 853 8.52e-4 SMART
ANK 858 887 2.18e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099709
AA Change: I166T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106937
Gene: ENSMUSG00000040479
AA Change: I166T

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
low complexity region 83 92 N/A INTRINSIC
C1 113 170 2.67e-1 SMART
C1 190 248 8.18e-7 SMART
low complexity region 274 291 N/A INTRINSIC
DAGKc 313 437 4.61e-65 SMART
DAGKa 464 621 2.75e-95 SMART
low complexity region 779 797 N/A INTRINSIC
ANK 840 870 8.52e-4 SMART
ANK 875 904 2.18e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111303
AA Change: I343T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106934
Gene: ENSMUSG00000040479
AA Change: I343T

DomainStartEndE-ValueType
low complexity region 39 58 N/A INTRINSIC
low complexity region 66 81 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 118 133 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
C1 290 347 2.67e-1 SMART
C1 367 425 8.18e-7 SMART
low complexity region 451 468 N/A INTRINSIC
DAGKc 490 614 4.61e-65 SMART
DAGKa 641 798 2.75e-95 SMART
low complexity region 956 974 N/A INTRINSIC
ANK 1017 1047 8.52e-4 SMART
ANK 1052 1081 2.18e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126473
Predicted Effect probably benign
Transcript: ENSMUST00000128152
SMART Domains Protein: ENSMUSP00000118684
Gene: ENSMUSG00000040479

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:C1 62 114 9e-33 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142090
Predicted Effect probably benign
Transcript: ENSMUST00000142231
AA Change: S60P

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000114740
Gene: ENSMUSG00000040479
AA Change: S60P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183498
Meta Mutation Damage Score 0.4814 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It may attenuate protein kinase C activity by regulating diacylglycerol levels in intracellular signaling cascade and signal transduction. Alternative splicing occurs at this locus and multiple transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Nov 2010]
PHENOTYPE: The T cell response is enhanced in homozygous mutant mice, which showed a robust response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Dgkz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Dgkz APN 2 91935865 missense probably benign 0.00
IGL01995:Dgkz APN 2 91934050 splice site probably benign
IGL02247:Dgkz APN 2 91937460 missense probably benign 0.00
IGL02573:Dgkz APN 2 91934197 missense probably damaging 0.98
IGL02627:Dgkz APN 2 91938710 splice site probably benign
IGL02903:Dgkz APN 2 91939962 missense possibly damaging 0.45
IGL03106:Dgkz APN 2 91940859 missense probably damaging 0.99
R0103:Dgkz UTSW 2 91934205 missense probably benign
R0312:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R0761:Dgkz UTSW 2 91945351 missense probably benign 0.00
R0839:Dgkz UTSW 2 91935111 missense probably benign 0.00
R1162:Dgkz UTSW 2 91944444 missense probably damaging 1.00
R1223:Dgkz UTSW 2 91939315 splice site probably benign
R1539:Dgkz UTSW 2 91938060 missense probably damaging 1.00
R1934:Dgkz UTSW 2 91937104 missense possibly damaging 0.92
R1936:Dgkz UTSW 2 91937978 missense possibly damaging 0.94
R3438:Dgkz UTSW 2 91934050 splice site probably benign
R3804:Dgkz UTSW 2 91939630 missense probably benign 0.06
R4675:Dgkz UTSW 2 91938346 nonsense probably null
R4731:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4732:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4733:Dgkz UTSW 2 91938339 missense probably damaging 1.00
R4901:Dgkz UTSW 2 91936731 missense probably benign
R4972:Dgkz UTSW 2 91945702 missense probably benign 0.00
R5027:Dgkz UTSW 2 91945543 missense probably benign 0.02
R5408:Dgkz UTSW 2 91935823 missense possibly damaging 0.91
R5494:Dgkz UTSW 2 91941049 splice site probably null
R5728:Dgkz UTSW 2 91945787 missense possibly damaging 0.93
R5813:Dgkz UTSW 2 91939388 missense possibly damaging 0.50
R6025:Dgkz UTSW 2 91945910 missense possibly damaging 0.75
R6043:Dgkz UTSW 2 91935889 missense probably benign 0.03
R6328:Dgkz UTSW 2 91942635 missense probably benign 0.04
R6335:Dgkz UTSW 2 91944379 missense probably benign 0.16
R7381:Dgkz UTSW 2 91944835 missense probably benign 0.02
R7541:Dgkz UTSW 2 91942675 missense probably damaging 1.00
R7560:Dgkz UTSW 2 91942815 unclassified probably benign
R7608:Dgkz UTSW 2 91934054 critical splice donor site probably null
R7624:Dgkz UTSW 2 91942674 missense probably damaging 1.00
R7709:Dgkz UTSW 2 91937059 missense probably benign 0.02
RF001:Dgkz UTSW 2 91939941 missense possibly damaging 0.83
X0002:Dgkz UTSW 2 91936562 missense probably damaging 0.97
X0021:Dgkz UTSW 2 91937119 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CTCTGCAGTCCCTTGGATAC -3'
(R):5'- AAGACCCTTTGACTAGCGGTC -3'

Sequencing Primer
(F):5'- TATGCAGACAGGACAGCTGACTTTC -3'
(R):5'- ACTAGCGGTCAGGAAGGCTTC -3'
Posted On2017-01-19