Incidental Mutation 'R0553:Fut2'
ID 45284
Institutional Source Beutler Lab
Gene Symbol Fut2
Ensembl Gene ENSMUSG00000055978
Gene Name fucosyltransferase 2
Synonyms
MMRRC Submission 038745-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45648591-45666394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 45651274 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 25 (I25F)
Ref Sequence ENSEMBL: ENSMUSP00000147471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069800] [ENSMUST00000210620]
AlphaFold Q9JL27
Predicted Effect probably damaging
Transcript: ENSMUST00000069800
AA Change: I25F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000063719
Gene: ENSMUSG00000055978
AA Change: I25F

DomainStartEndE-ValueType
Pfam:Glyco_transf_11 21 338 2.1e-139 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210620
AA Change: I25F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211324
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is involved in the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene results in altered glycosylation of gastric mucosa and uterine epithelia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. Females are somewhate more susceptible to infections withCandida albicans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Fut2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02814:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02831:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL02982:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03071:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03090:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03126:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03146:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03151:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03179:Fut2 APN 7 45650649 missense probably benign 0.02
IGL03212:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03213:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03234:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03271:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03372:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03381:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03385:Fut2 APN 7 45650769 missense possibly damaging 0.94
IGL03392:Fut2 APN 7 45650769 missense possibly damaging 0.94
PIT4515001:Fut2 UTSW 7 45650466 missense probably damaging 1.00
R1895:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R1946:Fut2 UTSW 7 45651324 missense probably damaging 1.00
R2347:Fut2 UTSW 7 45650328 missense probably damaging 0.99
R3155:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R3156:Fut2 UTSW 7 45650667 missense probably damaging 1.00
R4590:Fut2 UTSW 7 45650946 missense possibly damaging 0.64
R6311:Fut2 UTSW 7 45650380 missense possibly damaging 0.46
R6810:Fut2 UTSW 7 45650505 missense probably damaging 1.00
R6965:Fut2 UTSW 7 45650881 missense probably damaging 1.00
R8135:Fut2 UTSW 7 45651142 missense probably damaging 1.00
R9087:Fut2 UTSW 7 45651069 missense probably damaging 1.00
R9097:Fut2 UTSW 7 45650951 missense probably benign 0.01
R9462:Fut2 UTSW 7 45651068 missense probably damaging 1.00
X0066:Fut2 UTSW 7 45650374 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGATCCTGAAGATGGGCGCTAGAG -3'
(R):5'- GCACAATGCAGATGATTAGCCCAAC -3'

Sequencing Primer
(F):5'- AATGTAGCATATTCGCCCATCTG -3'
(R):5'- TTAGCCCAACGGATGTCAG -3'
Posted On 2013-06-11