Incidental Mutation 'R5034:Sdcbp'
ID452844
Institutional Source Beutler Lab
Gene Symbol Sdcbp
Ensembl Gene ENSMUSG00000028249
Gene Namesyndecan binding protein
Synonymssyntenin-1, syndecan interacting protein, syntenin, Sycl, MDA-9
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5034 (G1)
Quality Score181
Status Validated
Chromosome4
Chromosomal Location6365650-6408423 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 6393118 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029910] [ENSMUST00000029912] [ENSMUST00000103008] [ENSMUST00000108374] [ENSMUST00000153861] [ENSMUST00000175769]
Predicted Effect probably benign
Transcript: ENSMUST00000029910
SMART Domains Protein: ENSMUSP00000029910
Gene: ENSMUSG00000028245

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
GRAM 176 247 2.22e-11 SMART
Beach 302 575 6.28e-190 SMART
WD40 622 661 4.55e-3 SMART
WD40 664 703 2.97e0 SMART
WD40 706 743 1.47e-6 SMART
WD40 756 794 1.7e-2 SMART
WD40 797 836 1.02e-5 SMART
WD40 839 875 9.55e0 SMART
WD40 878 917 1.5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000029912
SMART Domains Protein: ENSMUSP00000029912
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
PDZ 208 274 6.04e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000103008
SMART Domains Protein: ENSMUSP00000100073
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
PDZ 207 273 6.04e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108374
SMART Domains Protein: ENSMUSP00000104011
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 2.84e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149015
Predicted Effect probably benign
Transcript: ENSMUST00000153861
SMART Domains Protein: ENSMUSP00000119838
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 123 194 7.09e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156715
Predicted Effect probably benign
Transcript: ENSMUST00000175769
SMART Domains Protein: ENSMUSP00000135777
Gene: ENSMUSG00000028249

DomainStartEndE-ValueType
PDZ 124 195 7.09e-15 SMART
Blast:PDZ 208 249 1e-21 BLAST
Meta Mutation Damage Score 0.9651 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was initially identified as a molecule linking syndecan-mediated signaling to the cytoskeleton. The syntenin protein contains tandemly repeated PDZ domains that bind the cytoplasmic, C-terminal domains of a variety of transmembrane proteins. This protein may also affect cytoskeletal-membrane organization, cell adhesion, protein trafficking, and the activation of transcription factors. The protein is primarily localized to membrane-associated adherens junctions and focal adhesions but is also found at the endoplasmic reticulum and nucleus. Alternative splicing results in multiple transcript variants encoding different isoforms. Related pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice heterozygous for a conditional allele activated in neurons exhibit abnormal dendrite morphology and reduced mEPSC frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tcf3 A G 10: 80,417,543 V218A possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Sdcbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Sdcbp APN 4 6392953 nonsense probably null
R0158:Sdcbp UTSW 4 6379042 missense possibly damaging 0.81
R1066:Sdcbp UTSW 4 6385120 missense probably damaging 0.98
R1115:Sdcbp UTSW 4 6377143 critical splice donor site probably null
R1353:Sdcbp UTSW 4 6381057 missense probably damaging 0.99
R2006:Sdcbp UTSW 4 6386536 missense probably benign 0.23
R4879:Sdcbp UTSW 4 6381056 missense possibly damaging 0.93
R4979:Sdcbp UTSW 4 6378980 nonsense probably null
R5072:Sdcbp UTSW 4 6393019 missense probably benign 0.07
R6307:Sdcbp UTSW 4 6385059 missense probably benign 0.06
R6329:Sdcbp UTSW 4 6381064 missense probably benign 0.04
R7483:Sdcbp UTSW 4 6393089 missense possibly damaging 0.95
R7665:Sdcbp UTSW 4 6385144 missense probably benign 0.11
R7722:Sdcbp UTSW 4 6385063 missense possibly damaging 0.93
R7729:Sdcbp UTSW 4 6378985 missense probably benign 0.06
R7807:Sdcbp UTSW 4 6393688 missense probably damaging 1.00
R8025:Sdcbp UTSW 4 6393022 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATCCCATGTGGCAGAGTTTG -3'
(R):5'- GACACGCATCCATTCAGAATG -3'

Sequencing Primer
(F):5'- ATGCTTCAGGCCCTTTGAACG -3'
(R):5'- GGGTCAACACAAAAGTCC -3'
Posted On2017-01-19