Incidental Mutation 'R5034:Tcf3'
ID452846
Institutional Source Beutler Lab
Gene Symbol Tcf3
Ensembl Gene ENSMUSG00000020167
Gene Nametranscription factor 3
SynonymsA1, ALF2, bHLHb21, E12, E2A, E47, Pan1, Pan2, Tcfe2a
MMRRC Submission 042625-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5034 (G1)
Quality Score80
Status Validated
Chromosome10
Chromosomal Location80409514-80433647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80417543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 218 (V218A)
Ref Sequence ENSEMBL: ENSMUSP00000100981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020377] [ENSMUST00000020379] [ENSMUST00000105339] [ENSMUST00000105340] [ENSMUST00000105341] [ENSMUST00000105342] [ENSMUST00000105343] [ENSMUST00000105344] [ENSMUST00000105345] [ENSMUST00000105346] [ENSMUST00000156244]
Predicted Effect probably benign
Transcript: ENSMUST00000020377
AA Change: V218A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000020377
Gene: ENSMUSG00000020167
AA Change: V218A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
HLH 553 606 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000020379
AA Change: V217A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020379
Gene: ENSMUSG00000020167
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105339
AA Change: V217A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100976
Gene: ENSMUSG00000020167
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
low complexity region 524 535 N/A INTRINSIC
HLH 549 602 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105340
AA Change: V217A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000100977
Gene: ENSMUSG00000020167
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105341
AA Change: V217A

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000100978
Gene: ENSMUSG00000020167
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 336 351 N/A INTRINSIC
low complexity region 458 476 N/A INTRINSIC
low complexity region 491 502 N/A INTRINSIC
HLH 546 599 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105342
AA Change: V218A

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000100979
Gene: ENSMUSG00000020167
AA Change: V218A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
HLH 554 607 2.66e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105343
AA Change: V218A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100980
Gene: ENSMUSG00000020167
AA Change: V218A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 462 480 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
HLH 550 603 8.79e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105344
AA Change: V218A

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100981
Gene: ENSMUSG00000020167
AA Change: V218A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 340 355 N/A INTRINSIC
low complexity region 463 481 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
HLH 551 604 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105345
AA Change: V217A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100982
Gene: ENSMUSG00000020167
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
HLH 549 602 8.79e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105346
AA Change: V217A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000100983
Gene: ENSMUSG00000020167
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 55 73 N/A INTRINSIC
low complexity region 125 148 N/A INTRINSIC
low complexity region 241 264 N/A INTRINSIC
low complexity region 339 354 N/A INTRINSIC
low complexity region 461 479 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 527 538 N/A INTRINSIC
HLH 552 605 2.66e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129027
Predicted Effect probably benign
Transcript: ENSMUST00000156244
SMART Domains Protein: ENSMUSP00000120303
Gene: ENSMUSG00000020167

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000156990
AA Change: V209A
SMART Domains Protein: ENSMUSP00000121172
Gene: ENSMUSG00000020167
AA Change: V209A

DomainStartEndE-ValueType
low complexity region 47 65 N/A INTRINSIC
low complexity region 117 140 N/A INTRINSIC
low complexity region 234 257 N/A INTRINSIC
low complexity region 329 344 N/A INTRINSIC
low complexity region 451 469 N/A INTRINSIC
low complexity region 484 495 N/A INTRINSIC
HLH 539 592 8.79e-11 SMART
Meta Mutation Damage Score 0.1646 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 97% (67/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the E protein (class I) family of helix-loop-helix transcription factors. E proteins activate transcription by binding to regulatory E-box sequences on target genes as heterodimers or homodimers, and are inhibited by heterodimerization with inhibitor of DNA-binding (class IV) helix-loop-helix proteins. E proteins play a critical role in lymphopoiesis, and the encoded protein is required for B and T lymphocyte development. Deletion of this gene or diminished activity of the encoded protein may play a role in lymphoid malignancies. This gene is also involved in several chromosomal translocations that are associated with lymphoid malignancies including pre-B-cell acute lymphoblastic leukemia (t(1;19), with PBX1), childhood leukemia (t(19;19), with TFPT) and acute leukemia (t(12;19), with ZNF384). Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the short arm of chromosome 9. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for targeted null mutations are devoid of mature B cells, have a partial early block in T-lymphocyte development, and show high postnatal mortality. Many survivors develop T-cell lymphomas between 3 and 10 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T C 7: 118,791,388 V368A probably damaging Het
Acaca T A 11: 84,245,264 S482T probably benign Het
Adam6b G T 12: 113,490,927 G455C probably damaging Het
Ahsg C A 16: 22,898,900 P237Q probably damaging Het
Asxl2 A G 12: 3,502,193 S1312G probably damaging Het
Brinp3 C T 1: 146,727,720 probably benign Het
Col12a1 T C 9: 79,657,367 H1677R probably damaging Het
Cops7a A G 6: 124,962,620 probably null Het
Csmd2 G A 4: 128,059,108 A117T probably damaging Het
Csmd3 T C 15: 47,629,287 R3153G possibly damaging Het
Dctn4 A G 18: 60,552,884 N342D probably benign Het
Dennd5a A T 7: 109,899,797 I953N probably damaging Het
Dmwd T C 7: 19,080,294 S290P probably damaging Het
Dsc1 T A 18: 20,095,027 Y424F possibly damaging Het
Far2 C A 6: 148,173,441 L391M probably benign Het
Foxd3 G A 4: 99,657,090 G156S probably damaging Het
Galk2 A T 2: 125,929,575 E173D probably benign Het
Hcar1 T C 5: 123,879,669 probably benign Het
Hsd17b11 C T 5: 104,018,221 V91M possibly damaging Het
Ighv1-77 C T 12: 115,861,874 C115Y probably damaging Het
Ighv9-2 A G 12: 114,109,405 F9S probably damaging Het
Kdm6b A G 11: 69,401,910 probably benign Het
Kif21a T A 15: 90,968,358 R890W probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Magel2 A T 7: 62,379,868 H840L unknown Het
Mrgpra4 A G 7: 47,981,569 F95L probably benign Het
Myo7b A G 18: 31,971,387 L1436P probably damaging Het
Nf1 C T 11: 79,444,150 P943S probably damaging Het
Obscn T A 11: 59,061,676 R4153* probably null Het
Olfr1026 C A 2: 85,923,547 S93Y probably damaging Het
Oosp2 T C 19: 11,651,535 I67M probably damaging Het
Pcdh9 T A 14: 93,326,849 D1023V probably benign Het
Pcdhb14 T C 18: 37,448,806 S322P probably damaging Het
Pde2a A G 7: 101,502,024 D285G probably benign Het
Pde5a G C 3: 122,852,586 G809R probably damaging Het
Pde5a G T 3: 122,852,587 G809V probably damaging Het
Pphln1 T C 15: 93,452,129 V120A probably benign Het
Rictor T C 15: 6,768,095 S311P probably damaging Het
Rilpl1 T C 5: 124,493,824 D153G probably damaging Het
Rmdn3 G T 2: 119,147,577 A181E probably damaging Het
Rnf213 G A 11: 119,410,807 V369M probably damaging Het
Scyl1 T A 19: 5,759,994 R601S probably benign Het
Sdcbp G A 4: 6,393,118 probably null Het
Sept8 A G 11: 53,534,438 T53A probably damaging Het
Sfpq A G 4: 127,023,669 probably benign Het
Slc35b3 A G 13: 38,943,158 Y163H probably damaging Het
Sra1 A G 18: 36,678,995 probably null Het
Sspo A T 6: 48,480,823 N3231Y possibly damaging Het
Tgm3 T C 2: 130,037,484 V332A possibly damaging Het
Tmprss11f C T 5: 86,591,384 probably benign Het
Trbv4 A G 6: 41,059,690 T50A probably benign Het
Trdv2-2 C A 14: 53,961,425 Y57* probably null Het
Trim50 T C 5: 135,367,293 V365A possibly damaging Het
Ubash3b T C 9: 41,029,740 Q245R probably benign Het
Ulk3 T A 9: 57,593,764 V338E possibly damaging Het
Usf3 A C 16: 44,216,399 K414T probably damaging Het
Usp48 C T 4: 137,606,757 R161* probably null Het
Vps18 A T 2: 119,293,306 D238V probably benign Het
Zfp354c T C 11: 50,815,039 E403G probably benign Het
Zscan18 A G 7: 12,774,145 V476A probably damaging Het
Other mutations in Tcf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Tcf3 APN 10 80413209 missense probably benign 0.30
IGL02676:Tcf3 APN 10 80421091 missense probably damaging 1.00
IGL03066:Tcf3 APN 10 80413045 missense probably damaging 0.97
R0165:Tcf3 UTSW 10 80412997 missense probably damaging 1.00
R0401:Tcf3 UTSW 10 80421158 missense probably damaging 0.99
R0624:Tcf3 UTSW 10 80413334 missense probably damaging 1.00
R2114:Tcf3 UTSW 10 80410206 missense probably damaging 1.00
R5144:Tcf3 UTSW 10 80415237 missense probably damaging 0.98
R5347:Tcf3 UTSW 10 80410211 missense probably damaging 1.00
R5418:Tcf3 UTSW 10 80427683 missense probably damaging 1.00
R5771:Tcf3 UTSW 10 80421616 intron probably benign
R5786:Tcf3 UTSW 10 80419499 missense probably benign 0.06
R5941:Tcf3 UTSW 10 80413044 missense probably benign 0.06
R6857:Tcf3 UTSW 10 80416899 intron probably null
R6982:Tcf3 UTSW 10 80417550 missense probably damaging 1.00
R7178:Tcf3 UTSW 10 80421599 missense unknown
R7840:Tcf3 UTSW 10 80410467 missense possibly damaging 0.87
R7923:Tcf3 UTSW 10 80410467 missense possibly damaging 0.87
X0022:Tcf3 UTSW 10 80417458 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCTACCATGCGATCCTG -3'
(R):5'- CATTAGGTTTCTAGGACCTCCAG -3'

Sequencing Primer
(F):5'- ATGCGATCCTGCTGCTG -3'
(R):5'- TCCAGGGCCTAGGCATG -3'
Posted On2017-01-19