Mutagenetix > Incidental Mutations

Incidental Mutation 'R0553:Galnt7'

45286

Institutional Source

Beutler Lab

Gene Symbol

Galnt7

Ensembl Gene

ENSMUSG00000031608

Gene Name

polypeptide N-acetylgalactosaminyltransferase 7

Synonyms

ppGaNTase-T7

MMRRC Submission

038745-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.732) question?

Stock #

R0553 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

57523828-57653032 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 57552430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105945 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]

AlphaFold

Q80VA0

Predicted Effect

probably benign
Transcript: ENSMUST00000034021

SMART Domains

Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	3e-28	PFAM
Pfam:Glyco_tranf_2_2	210	490	2e-7	PFAM
Pfam:Glyco_transf_7C	375	445	1.8e-8	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104338

Predicted Effect

probably benign
Transcript: ENSMUST00000110316

SMART Domains

Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
low complexity region	48	62	N/A	INTRINSIC
low complexity region	136	152	N/A	INTRINSIC
Pfam:Glycos_transf_2	210	399	8.2e-27	PFAM
Pfam:Glyco_tranf_2_2	210	490	1.3e-7	PFAM
Pfam:Glyco_transf_7C	369	445	9.3e-9	PFAM
RICIN	531	652	3.39e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156907

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.6%
20x: 93.1%

Validation Efficiency

100% (42/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	T	C	14: 49,682,686	I729V	probably damaging	Het
9530002B09Rik	A	T	4: 122,702,335	M120L	unknown	Het
Adamts13	T	A	2: 26,991,334	C774*	probably null	Het
Amh	A	G	10: 80,806,176		probably benign	Het
Ccdc173	C	A	2: 69,789,441	R8L	probably damaging	Het
Cd40	G	A	2: 165,070,741	R204Q	probably benign	Het
Clhc1	A	C	11: 29,561,366		probably benign	Het
Fbxl17	G	A	17: 63,356,851	R67C	probably damaging	Het
Flg2	A	T	3: 93,203,584	H973L	unknown	Het
Fut2	T	A	7: 45,651,274	I25F	probably damaging	Het
Gm438	T	A	4: 144,777,415	I389L	possibly damaging	Het
Gm7534	T	C	4: 134,202,518	T159A	possibly damaging	Het
Gm8909	G	T	17: 36,168,057	P100Q	probably damaging	Het
Gmppb	A	T	9: 108,049,797	M56L	probably benign	Het
Grm3	C	A	5: 9,570,048	A399S	probably benign	Het
Hey2	G	A	10: 30,840,489		probably benign	Het
Ift172	A	G	5: 31,275,842		probably benign	Het
Kcnh5	C	A	12: 75,137,673	C92F	probably benign	Het
Kdm1a	T	C	4: 136,555,298	D229G	probably damaging	Het
Klf11	C	G	12: 24,655,090	P164R	probably benign	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Krtcap3	T	C	5: 31,251,803	V6A	probably benign	Het
Ltbr	A	C	6: 125,313,388		probably null	Het
Mmp17	T	G	5: 129,598,670	S298A	probably benign	Het
Nacc2	T	A	2: 26,089,590	E278V	possibly damaging	Het
Olfr175-ps1	A	T	16: 58,824,155	Y185N	probably damaging	Het
Olfr875	T	A	9: 37,773,331	I224N	probably benign	Het
Otop2	C	T	11: 115,329,462	A376V	probably damaging	Het
Pdia2	T	C	17: 26,196,243	E504G	probably damaging	Het
Pdzph1	C	T	17: 58,922,727	V979M	probably damaging	Het
Pou5f1	A	G	17: 35,509,477	K86R	possibly damaging	Het
Ptprq	A	G	10: 107,710,627	F269L	probably benign	Het
Rb1	A	T	14: 73,211,712	C659*	probably null	Het
Rnf8	T	C	17: 29,621,639		probably null	Het
Rras	T	G	7: 45,020,556	I137M	probably benign	Het
Slc38a9	A	T	13: 112,714,198	H372L	probably damaging	Het
Spata9	T	C	13: 75,977,779		probably null	Het
Tas2r115	T	C	6: 132,737,959	T10A	probably benign	Het
Ttn	T	C	2: 76,798,893	E12621G	probably damaging	Het
Unc80	A	T	1: 66,506,669	I460F	probably damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zbtb24	C	T	10: 41,451,997	A293V	possibly damaging	Het

Other mutations in Galnt7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Galnt7	APN	8	57540039	missense	probably damaging	1.00
IGL00538:Galnt7	APN	8	57552522	missense	possibly damaging	0.95
IGL00826:Galnt7	APN	8	57540071	nonsense	probably null
IGL00951:Galnt7	APN	8	57583824	missense	probably damaging	0.96
IGL01662:Galnt7	APN	8	57531735	splice site	probably benign
IGL02280:Galnt7	APN	8	57536790	missense	probably damaging	1.00
IGL02832:Galnt7	APN	8	57552497	missense	probably damaging	1.00
IGL02936:Galnt7	APN	8	57584214	missense	probably benign
IGL03083:Galnt7	APN	8	57526189	missense	probably damaging	0.98
IGL03387:Galnt7	APN	8	57526178	missense	probably benign	0.01
R0400:Galnt7	UTSW	8	57583989	missense	probably damaging	0.99
R1463:Galnt7	UTSW	8	57652858	missense	probably benign
R1487:Galnt7	UTSW	8	57540039	missense	probably damaging	1.00
R1791:Galnt7	UTSW	8	57542530	missense	probably benign	0.05
R1817:Galnt7	UTSW	8	57538178	missense	probably damaging	1.00
R1962:Galnt7	UTSW	8	57532714	missense	probably benign	0.13
R3855:Galnt7	UTSW	8	57532624	splice site	probably benign
R3856:Galnt7	UTSW	8	57532624	splice site	probably benign
R4232:Galnt7	UTSW	8	57652966	missense	probably benign
R4396:Galnt7	UTSW	8	57538181	missense	probably damaging	1.00
R4426:Galnt7	UTSW	8	57552572	nonsense	probably null
R4610:Galnt7	UTSW	8	57545769	missense	probably damaging	0.99
R4745:Galnt7	UTSW	8	57542727	intron	probably benign
R4794:Galnt7	UTSW	8	57545363	missense	probably damaging	1.00
R5014:Galnt7	UTSW	8	57545380	missense	probably damaging	1.00
R5177:Galnt7	UTSW	8	57584027	missense	possibly damaging	0.87
R5682:Galnt7	UTSW	8	57583933	nonsense	probably null
R6122:Galnt7	UTSW	8	57526166	missense	probably damaging	0.99
R6276:Galnt7	UTSW	8	57536578	splice site	probably null
R6684:Galnt7	UTSW	8	57538109	missense	probably benign	0.16
R6752:Galnt7	UTSW	8	57652951	missense	probably damaging	1.00
R7464:Galnt7	UTSW	8	57584020	missense	possibly damaging	0.95
R7491:Galnt7	UTSW	8	57552518	missense	probably damaging	0.97
R7547:Galnt7	UTSW	8	57583962	missense	possibly damaging	0.48
R8093:Galnt7	UTSW	8	57532705	missense	probably benign	0.00
R8221:Galnt7	UTSW	8	57552566	missense	possibly damaging	0.93
R8248:Galnt7	UTSW	8	57538188	missense	probably benign	0.34
R8402:Galnt7	UTSW	8	57542919	missense	probably damaging	0.98
R8779:Galnt7	UTSW	8	57584211	missense	probably benign
R8894:Galnt7	UTSW	8	57526142	nonsense	probably null
R8974:Galnt7	UTSW	8	57652900	missense
R9106:Galnt7	UTSW	8	57532695	missense	probably damaging	1.00
R9297:Galnt7	UTSW	8	57542521	missense	probably damaging	0.98
X0050:Galnt7	UTSW	8	57552444	frame shift	probably null
X0062:Galnt7	UTSW	8	57583908	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CTTTGAGGGGCAGCGCAAAATAC -3'
(R):5'- ATACAAGCCCAGGGACTCTGAAGC -3'

Sequencing Primer
(F):5'- attactgcctctgtgcctg -3'
(R):5'- TTGCAGATGCAAGTATTGGCAC -3'

Posted On

2013-06-11