Incidental Mutation 'R0553:Galnt7'
ID 45286
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Name polypeptide N-acetylgalactosaminyltransferase 7
Synonyms ppGaNTase-T7
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock # R0553 (G1)
Quality Score 224
Status Validated
Chromosome 8
Chromosomal Location 57523828-57653032 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 57552430 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
AlphaFold Q80VA0
Predicted Effect probably benign
Transcript: ENSMUST00000034021
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104338
Predicted Effect probably benign
Transcript: ENSMUST00000110316
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156907
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57540039 missense probably damaging 1.00
IGL00538:Galnt7 APN 8 57552522 missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57540071 nonsense probably null
IGL00951:Galnt7 APN 8 57583824 missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57531735 splice site probably benign
IGL02280:Galnt7 APN 8 57536790 missense probably damaging 1.00
IGL02832:Galnt7 APN 8 57552497 missense probably damaging 1.00
IGL02936:Galnt7 APN 8 57584214 missense probably benign
IGL03083:Galnt7 APN 8 57526189 missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57526178 missense probably benign 0.01
R0400:Galnt7 UTSW 8 57583989 missense probably damaging 0.99
R1463:Galnt7 UTSW 8 57652858 missense probably benign
R1487:Galnt7 UTSW 8 57540039 missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57542530 missense probably benign 0.05
R1817:Galnt7 UTSW 8 57538178 missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57532714 missense probably benign 0.13
R3855:Galnt7 UTSW 8 57532624 splice site probably benign
R3856:Galnt7 UTSW 8 57532624 splice site probably benign
R4232:Galnt7 UTSW 8 57652966 missense probably benign
R4396:Galnt7 UTSW 8 57538181 missense probably damaging 1.00
R4426:Galnt7 UTSW 8 57552572 nonsense probably null
R4610:Galnt7 UTSW 8 57545769 missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57542727 intron probably benign
R4794:Galnt7 UTSW 8 57545363 missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57545380 missense probably damaging 1.00
R5177:Galnt7 UTSW 8 57584027 missense possibly damaging 0.87
R5682:Galnt7 UTSW 8 57583933 nonsense probably null
R6122:Galnt7 UTSW 8 57526166 missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57536578 splice site probably null
R6684:Galnt7 UTSW 8 57538109 missense probably benign 0.16
R6752:Galnt7 UTSW 8 57652951 missense probably damaging 1.00
R7464:Galnt7 UTSW 8 57584020 missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 57552518 missense probably damaging 0.97
R7547:Galnt7 UTSW 8 57583962 missense possibly damaging 0.48
R8093:Galnt7 UTSW 8 57532705 missense probably benign 0.00
R8221:Galnt7 UTSW 8 57552566 missense possibly damaging 0.93
R8248:Galnt7 UTSW 8 57538188 missense probably benign 0.34
R8402:Galnt7 UTSW 8 57542919 missense probably damaging 0.98
R8779:Galnt7 UTSW 8 57584211 missense probably benign
R8894:Galnt7 UTSW 8 57526142 nonsense probably null
R8974:Galnt7 UTSW 8 57652900 missense
R9106:Galnt7 UTSW 8 57532695 missense probably damaging 1.00
R9297:Galnt7 UTSW 8 57542521 missense probably damaging 0.98
X0050:Galnt7 UTSW 8 57552444 frame shift probably null
X0062:Galnt7 UTSW 8 57583908 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTTGAGGGGCAGCGCAAAATAC -3'
(R):5'- ATACAAGCCCAGGGACTCTGAAGC -3'

Sequencing Primer
(F):5'- attactgcctctgtgcctg -3'
(R):5'- TTGCAGATGCAAGTATTGGCAC -3'
Posted On 2013-06-11