Incidental Mutation 'R0553:Olfr875'
ID 45287
Institutional Source Beutler Lab
Gene Symbol Olfr875
Ensembl Gene ENSMUSG00000058628
Gene Name olfactory receptor 875
Synonyms GA_x6K02T2PVTD-31458511-31459443, MOR161-4
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 37771857-37774459 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37773331 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 224 (I224N)
Ref Sequence ENSEMBL: ENSMUSP00000150684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080634] [ENSMUST00000215128]
AlphaFold Q7TRE5
Predicted Effect probably benign
Transcript: ENSMUST00000080634
AA Change: I224N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000079467
Gene: ENSMUSG00000058628
AA Change: I224N

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 1.1e-48 PFAM
Pfam:7tm_1 40 289 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215128
AA Change: I224N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.5839 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Olfr875
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01909:Olfr875 APN 9 37772863 missense possibly damaging 0.95
IGL02013:Olfr875 APN 9 37772889 missense probably benign 0.00
IGL02162:Olfr875 APN 9 37772931 missense probably benign 0.13
IGL02966:Olfr875 APN 9 37773586 missense probably benign 0.28
R0017:Olfr875 UTSW 9 37772978 missense probably benign 0.08
R0520:Olfr875 UTSW 9 37773553 missense probably benign 0.00
R0833:Olfr875 UTSW 9 37773076 missense probably benign 0.03
R1316:Olfr875 UTSW 9 37772743 missense possibly damaging 0.94
R1547:Olfr875 UTSW 9 37772664 missense probably benign 0.00
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1888:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1891:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R1894:Olfr875 UTSW 9 37772867 missense possibly damaging 0.88
R3055:Olfr875 UTSW 9 37773193 missense probably damaging 1.00
R4816:Olfr875 UTSW 9 37773430 missense possibly damaging 0.72
R4829:Olfr875 UTSW 9 37772947 missense probably damaging 1.00
R4952:Olfr875 UTSW 9 37773064 missense probably damaging 0.99
R6111:Olfr875 UTSW 9 37772932 missense probably damaging 0.99
R6838:Olfr875 UTSW 9 37773052 missense possibly damaging 0.87
R7101:Olfr875 UTSW 9 37772991 missense probably damaging 0.99
R7104:Olfr875 UTSW 9 37773141 missense possibly damaging 0.64
R7224:Olfr875 UTSW 9 37773415 missense possibly damaging 0.95
R7334:Olfr875 UTSW 9 37772997 missense probably damaging 0.97
R7582:Olfr875 UTSW 9 37772821 missense probably damaging 1.00
R7909:Olfr875 UTSW 9 37772737 missense probably damaging 1.00
R8498:Olfr875 UTSW 9 37773264 missense probably damaging 1.00
R9158:Olfr875 UTSW 9 37773504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTGACCTTCTGTGCTGACAACC -3'
(R):5'- TGACCAGTCACACCACTGTAGCTC -3'

Sequencing Primer
(F):5'- TGTGCTGACAACCTCATCAATC -3'
(R):5'- ACCACTGTAGCTCATGATACTG -3'
Posted On 2013-06-11