Incidental Mutation 'R0553:Gmppb'
ID 45288
Institutional Source Beutler Lab
Gene Symbol Gmppb
Ensembl Gene ENSMUSG00000070284
Gene Name GDP-mannose pyrophosphorylase B
Synonyms
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 108049242-108052801 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108049797 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 56 (M56L)
Ref Sequence ENSEMBL: ENSMUSP00000107914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000047746] [ENSMUST00000047947] [ENSMUST00000085060] [ENSMUST00000112295] [ENSMUST00000160249] [ENSMUST00000178267] [ENSMUST00000160649] [ENSMUST00000164395] [ENSMUST00000176566] [ENSMUST00000162355] [ENSMUST00000177158]
AlphaFold Q8BTZ7
Predicted Effect probably benign
Transcript: ENSMUST00000035214
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000047746
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047947
AA Change: M56L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000036898
Gene: ENSMUSG00000070284
AA Change: M56L

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 234 8e-48 PFAM
Pfam:NTP_transf_3 3 202 6.6e-12 PFAM
Pfam:Hexapep 259 294 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085060
SMART Domains Protein: ENSMUSP00000082137
Gene: ENSMUSG00000032593

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LRRNT 33 65 2.55e-2 SMART
LRR 65 83 6.97e1 SMART
LRR_TYP 84 107 1.56e-2 SMART
LRR 109 131 2.84e1 SMART
LRR 132 155 7.05e-1 SMART
LRR 156 176 3.98e1 SMART
LRR 182 206 5.56e0 SMART
Blast:LRRCT 219 274 8e-23 BLAST
IG 285 372 1.59e-6 SMART
transmembrane domain 383 405 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
low complexity region 492 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112295
AA Change: M56L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107914
Gene: ENSMUSG00000070284
AA Change: M56L

DomainStartEndE-ValueType
Pfam:NTP_transferase 2 235 2.1e-51 PFAM
Pfam:NTP_transf_3 3 199 1.1e-11 PFAM
Pfam:Hexapep 259 294 9.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137284
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150700
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159526
Predicted Effect probably benign
Transcript: ENSMUST00000160249
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161673
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167159
Predicted Effect probably benign
Transcript: ENSMUST00000178267
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160649
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164395
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Predicted Effect probably benign
Transcript: ENSMUST00000176613
Predicted Effect probably benign
Transcript: ENSMUST00000162355
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177158
SMART Domains Protein: ENSMUSP00000134754
Gene: ENSMUSG00000032594

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Pfam:IPK 108 206 1.5e-26 PFAM
Meta Mutation Damage Score 0.1262 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to encode a GDP-mannose pyrophosphorylase. The encoded protein catalyzes the conversion of mannose-1-phosphate and GTP to GDP-mannose, a reaction involved in the production of N-linked oligosaccharides. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Hey2 G A 10: 30,840,489 probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Gmppb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Gmppb APN 9 108051247 splice site probably null
IGL02685:Gmppb APN 9 108049919 unclassified probably benign
R0308:Gmppb UTSW 9 108049834 missense probably benign 0.28
R3804:Gmppb UTSW 9 108050574 missense probably damaging 1.00
R3973:Gmppb UTSW 9 108050139 missense probably benign 0.01
R4801:Gmppb UTSW 9 108050217 missense probably benign 0.02
R4802:Gmppb UTSW 9 108050217 missense probably benign 0.02
R5424:Gmppb UTSW 9 108052005 splice site probably null
R7809:Gmppb UTSW 9 108051455 makesense probably null
R7895:Gmppb UTSW 9 108050571 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAATAAGCCCATCTTGCTGCATC -3'
(R):5'- TTGCTGGCCCTAAAGTTTGCCC -3'

Sequencing Primer
(F):5'- CATCTTGCTGCATCAAGTGGAG -3'
(R):5'- TTATACTGACCTGTCCCCAAAGG -3'
Posted On 2013-06-11