Incidental Mutation 'R5024:Frmd3'
ID 452886
Institutional Source Beutler Lab
Gene Symbol Frmd3
Ensembl Gene ENSMUSG00000049122
Gene Name FERM domain containing 3
Synonyms 4.1O, EPB41L4O, 9430066I12Rik, P410
MMRRC Submission 042615-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.300) question?
Stock # R5024 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 73931679-74120451 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74016381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 99 (S99T)
Ref Sequence ENSEMBL: ENSMUSP00000095615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084474] [ENSMUST00000098006]
AlphaFold Q8BHD4
Predicted Effect probably benign
Transcript: ENSMUST00000084474
AA Change: S99T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081514
Gene: ENSMUSG00000049122
AA Change: S99T

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098006
AA Change: S99T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000095615
Gene: ENSMUSG00000049122
AA Change: S99T

DomainStartEndE-ValueType
B41 28 225 5.17e-57 SMART
FERM_C 229 316 1.93e-18 SMART
FA 322 368 4.1e-13 SMART
low complexity region 391 401 N/A INTRINSIC
transmembrane domain 529 551 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single pass membrane protein primarily found in ovaries. A similar protein in erythrocytes helps determine the shape of red blood cells, but the function of the encoded protein has not been determined. There is some evidence that this is a tumor suppressor gene, and there is also evidence linking defects in this gene to susceptibility to diabetic nephropathy in type 1 diabetes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 A G 5: 129,248,959 (GRCm39) N575S probably damaging Het
Akap6 C T 12: 53,189,345 (GRCm39) T2253M probably benign Het
Arhgef37 A C 18: 61,639,511 (GRCm39) N289K probably damaging Het
Atad2b A C 12: 4,987,534 (GRCm39) T121P probably benign Het
Atp4a A C 7: 30,415,289 (GRCm39) D303A possibly damaging Het
Calu A T 6: 29,374,518 (GRCm39) probably benign Het
Ccdc141 A C 2: 76,885,047 (GRCm39) N531K probably benign Het
Ccdc146 T C 5: 21,604,612 (GRCm39) probably null Het
Cd207 G A 6: 83,651,301 (GRCm39) T218I probably damaging Het
Cd2ap A C 17: 43,116,236 (GRCm39) probably null Het
Ceacam23 A G 7: 17,644,607 (GRCm39) I575V probably benign Het
Clip3 G A 7: 29,991,644 (GRCm39) probably benign Het
Clstn1 G A 4: 149,719,751 (GRCm39) R432H possibly damaging Het
Csmd2 A G 4: 128,215,141 (GRCm39) Y521C possibly damaging Het
Dnah8 A T 17: 30,955,070 (GRCm39) E2033V probably damaging Het
Eng T G 2: 32,563,404 (GRCm39) V319G probably benign Het
Erp44 C T 4: 48,241,296 (GRCm39) W57* probably null Het
Etv1 T A 12: 38,904,233 (GRCm39) probably null Het
Eva1c T C 16: 90,673,081 (GRCm39) probably null Het
Fam221b T A 4: 43,659,674 (GRCm39) N482I probably damaging Het
Fam83h T C 15: 75,876,991 (GRCm39) H202R probably damaging Het
Fbxw13 T C 9: 109,008,403 (GRCm39) T449A probably benign Het
Fbxw25 A T 9: 109,492,442 (GRCm39) probably null Het
Gm5174 G T 10: 86,492,451 (GRCm39) noncoding transcript Het
Gm815 C T 19: 26,865,175 (GRCm39) Q49* probably null Het
H2-DMa A T 17: 34,357,461 (GRCm39) I245F possibly damaging Het
Herc1 A T 9: 66,377,608 (GRCm39) K3458M possibly damaging Het
Hirip3 A G 7: 126,463,661 (GRCm39) probably null Het
Hjurp A T 1: 88,202,772 (GRCm39) Y71N possibly damaging Het
Hmcn1 T A 1: 150,556,439 (GRCm39) E2449V possibly damaging Het
Igll1 G T 16: 16,681,657 (GRCm39) H33N probably benign Het
Il6 T C 5: 30,224,512 (GRCm39) L184P probably damaging Het
Impg2 T A 16: 56,080,463 (GRCm39) S756T probably damaging Het
Insyn2a A G 7: 134,520,207 (GRCm39) S108P probably damaging Het
Kank4 T G 4: 98,673,898 (GRCm39) D5A probably damaging Het
Kcna7 G A 7: 45,056,015 (GRCm39) R77H probably damaging Het
Kcns2 A T 15: 34,839,683 (GRCm39) T349S probably benign Het
Keap1 A G 9: 21,148,522 (GRCm39) Y162H probably damaging Het
Kif9 T C 9: 110,312,161 (GRCm39) F10L possibly damaging Het
Klhdc8b ACACGCACGCACGCACGCACGCACGCACGCACGCACGCAC ACACGCACGCACGCACGCACGCACGCACGCACGCACGCACGCAC 9: 108,326,184 (GRCm39) probably benign Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lpar6 A G 14: 73,476,809 (GRCm39) T257A probably damaging Het
Lpin1 A T 12: 16,604,007 (GRCm39) L608Q probably benign Het
Lyst T C 13: 13,808,989 (GRCm39) S220P probably benign Het
M1ap A G 6: 83,005,339 (GRCm39) probably benign Het
Mbd6 C T 10: 127,122,310 (GRCm39) V173I probably benign Het
Myo5b A T 18: 74,849,105 (GRCm39) T1115S possibly damaging Het
Mysm1 C A 4: 94,839,253 (GRCm39) V683F possibly damaging Het
Nlrp4g T A 9: 124,350,155 (GRCm38) noncoding transcript Het
Odad2 T C 18: 7,088,555 (GRCm39) M1005V probably benign Het
Or14c39 A T 7: 86,344,089 (GRCm39) M142L probably benign Het
Or2ak5 T A 11: 58,611,776 (GRCm39) I33F probably benign Het
Or5al6 G T 2: 85,976,877 (GRCm39) A67E probably damaging Het
Or8j3c C T 2: 86,253,805 (GRCm39) G72S possibly damaging Het
Otud6b T A 4: 14,826,293 (GRCm39) Q34L probably damaging Het
Parp11 C T 6: 127,448,599 (GRCm39) T72I probably damaging Het
Pbx1 T A 1: 168,011,158 (GRCm39) D343V possibly damaging Het
Phf11 T C 14: 59,495,932 (GRCm39) probably null Het
Ppp1r12b G T 1: 134,883,471 (GRCm39) A17E probably benign Het
Pramel15 C A 4: 144,099,878 (GRCm39) E296* probably null Het
Ranbp9 A T 13: 43,588,331 (GRCm39) I67N probably damaging Het
Rasgrp4 A G 7: 28,847,832 (GRCm39) E414G probably damaging Het
Rbbp5 A G 1: 132,418,226 (GRCm39) H15R possibly damaging Het
Scd2 A G 19: 44,289,710 (GRCm39) Y235C probably benign Het
Sdr16c5 C T 4: 4,010,365 (GRCm39) G170S probably damaging Het
Sh3bp4 G T 1: 89,073,317 (GRCm39) G722C probably damaging Het
Shmt1 A T 11: 60,688,305 (GRCm39) probably benign Het
Slc12a1 A G 2: 125,008,057 (GRCm39) I206V probably benign Het
Slc26a3 A G 12: 31,503,907 (GRCm39) D304G probably benign Het
Slc26a7 T A 4: 14,532,572 (GRCm39) D434V possibly damaging Het
Slc6a16 G T 7: 44,909,390 (GRCm39) M185I probably benign Het
Stat4 A G 1: 52,121,729 (GRCm39) I363V possibly damaging Het
Tgfb1i1 G T 7: 127,847,389 (GRCm39) M1I probably null Het
Thoc2l A G 5: 104,670,124 (GRCm39) K1549E possibly damaging Het
Tmem225 T C 9: 40,060,639 (GRCm39) V66A probably benign Het
Tmtc4 T C 14: 123,178,714 (GRCm39) probably null Het
Trpc4 T A 3: 54,102,217 (GRCm39) N38K probably benign Het
Ttll12 A T 15: 83,471,314 (GRCm39) Y218N probably damaging Het
Ttn A T 2: 76,778,769 (GRCm39) probably null Het
Tulp1 A C 17: 28,570,969 (GRCm39) Y178* probably null Het
Vmn2r58 A G 7: 41,513,746 (GRCm39) V299A probably damaging Het
Washc4 C A 10: 83,419,200 (GRCm39) Q911K possibly damaging Het
Wdr3 T C 3: 100,062,252 (GRCm39) D221G probably benign Het
Zan A T 5: 137,460,155 (GRCm39) C1245* probably null Het
Zfyve9 A C 4: 108,548,866 (GRCm39) S773A probably benign Het
Other mutations in Frmd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Frmd3 APN 4 73,992,357 (GRCm39) missense possibly damaging 0.62
IGL01774:Frmd3 APN 4 74,106,075 (GRCm39) missense probably damaging 1.00
IGL02213:Frmd3 APN 4 74,054,109 (GRCm39) missense probably benign 0.36
IGL02479:Frmd3 APN 4 74,105,752 (GRCm39) missense probably benign 0.30
IGL03248:Frmd3 APN 4 74,046,455 (GRCm39) missense possibly damaging 0.71
R0765:Frmd3 UTSW 4 74,080,004 (GRCm39) missense probably damaging 1.00
R1411:Frmd3 UTSW 4 74,071,858 (GRCm39) missense probably damaging 1.00
R1535:Frmd3 UTSW 4 73,931,995 (GRCm39) start gained probably benign
R1990:Frmd3 UTSW 4 74,105,676 (GRCm39) missense probably damaging 1.00
R3898:Frmd3 UTSW 4 73,992,346 (GRCm39) missense probably damaging 1.00
R4377:Frmd3 UTSW 4 74,046,535 (GRCm39) critical splice donor site probably null
R4616:Frmd3 UTSW 4 74,106,109 (GRCm39) missense probably benign 0.15
R4965:Frmd3 UTSW 4 74,071,837 (GRCm39) missense probably damaging 1.00
R5104:Frmd3 UTSW 4 74,063,315 (GRCm39) missense probably damaging 1.00
R5418:Frmd3 UTSW 4 74,079,935 (GRCm39) critical splice acceptor site probably null
R5434:Frmd3 UTSW 4 74,106,033 (GRCm39) missense probably damaging 1.00
R5878:Frmd3 UTSW 4 74,071,847 (GRCm39) missense probably damaging 1.00
R5999:Frmd3 UTSW 4 74,088,928 (GRCm39) missense possibly damaging 0.49
R6031:Frmd3 UTSW 4 74,105,688 (GRCm39) missense probably damaging 0.99
R6031:Frmd3 UTSW 4 74,105,688 (GRCm39) missense probably damaging 0.99
R6616:Frmd3 UTSW 4 74,105,725 (GRCm39) missense probably damaging 0.97
R6813:Frmd3 UTSW 4 74,077,482 (GRCm39) missense probably benign 0.00
R6941:Frmd3 UTSW 4 74,016,363 (GRCm39) missense probably benign 0.20
R7233:Frmd3 UTSW 4 73,932,023 (GRCm39) missense probably benign 0.09
R7334:Frmd3 UTSW 4 74,079,955 (GRCm39) missense probably benign 0.02
R7429:Frmd3 UTSW 4 74,063,342 (GRCm39) missense probably damaging 0.98
R7430:Frmd3 UTSW 4 74,063,342 (GRCm39) missense probably damaging 0.98
R7979:Frmd3 UTSW 4 74,071,852 (GRCm39) missense probably damaging 1.00
R8693:Frmd3 UTSW 4 74,080,286 (GRCm39) missense probably damaging 0.97
R8994:Frmd3 UTSW 4 74,088,985 (GRCm39) missense probably benign
R9065:Frmd3 UTSW 4 74,063,269 (GRCm39) critical splice acceptor site probably null
R9351:Frmd3 UTSW 4 74,054,068 (GRCm39) missense probably damaging 1.00
R9498:Frmd3 UTSW 4 74,038,055 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCAGTCAAATGTCCCTTCCCAG -3'
(R):5'- TGTTATTGGAACCCAGGTCAGAG -3'

Sequencing Primer
(F):5'- TGCACCAGATGTTAGCTCAG -3'
(R):5'- TATTGGAACCCAGGTCAGAGAAAAAG -3'
Posted On 2017-01-23