Mutagenetix > Incidental Mutation

Incidental Mutation 'R4999:Pkd1l2'

452889

Institutional Source

Beutler Lab

Gene Symbol

Pkd1l2

Ensembl Gene

ENSMUSG00000034416

Gene Name

polycystic kidney disease 1 like 2

Synonyms

MMRRC Submission

042593-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4999 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

116995679-117082449 bp(-) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

C to T at 117047374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000095977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098375] [ENSMUST00000109093]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000098375

SMART Domains

Protein: ENSMUSP00000095977
Gene: ENSMUSG00000034416

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	1.8e-18	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	510	886	1.8e-13	PFAM
low complexity region	1050	1060	N/A	INTRINSIC
GPS	1278	1327	1.61e-11	SMART
transmembrane domain	1346	1365	N/A	INTRINSIC
LH2	1390	1509	6.05e-13	SMART
transmembrane domain	1552	1574	N/A	INTRINSIC
transmembrane domain	1589	1611	N/A	INTRINSIC
transmembrane domain	1815	1837	N/A	INTRINSIC
transmembrane domain	1852	1874	N/A	INTRINSIC
transmembrane domain	1940	1962	N/A	INTRINSIC
Pfam:PKD_channel	1980	2403	6.4e-107	PFAM
Pfam:Ion_trans	2187	2396	2.5e-12	PFAM
low complexity region	2441	2458	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109093

SMART Domains

Protein: ENSMUSP00000104721
Gene: ENSMUSG00000034416

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CLECT	26	152	1.56e-21	SMART
Pfam:Gal_Lectin	168	250	6.9e-19	PFAM
PKD	260	341	3.84e-1	SMART
low complexity region	496	507	N/A	INTRINSIC
Pfam:REJ	519	883	7e-11	PFAM
low complexity region	1051	1061	N/A	INTRINSIC
GPS	1279	1328	1.61e-11	SMART
transmembrane domain	1347	1366	N/A	INTRINSIC
LH2	1391	1510	6.05e-13	SMART
transmembrane domain	1553	1575	N/A	INTRINSIC
transmembrane domain	1590	1612	N/A	INTRINSIC
transmembrane domain	1816	1838	N/A	INTRINSIC
transmembrane domain	1853	1875	N/A	INTRINSIC
transmembrane domain	1941	1963	N/A	INTRINSIC
Pfam:PKD_channel	1981	2403	5.9e-106	PFAM
Pfam:Ion_trans	2138	2409	3.4e-12	PFAM
low complexity region	2442	2459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153724

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, where some individuals contain a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930444P10Rik	A	G	1: 16,068,798		probably null	Het
Abca4	T	A	3: 122,105,370	V667D	probably damaging	Het
Aco1	A	G	4: 40,176,507	I224V	probably damaging	Het
Arel1	C	T	12: 84,931,767	V364M	probably damaging	Het
Arhgap42	A	G	9: 9,009,434	V484A	probably damaging	Het
Asap2	T	C	12: 21,252,765	F681L	probably benign	Het
Atrn	C	A	2: 130,975,954	D809E	probably damaging	Het
BC037034	T	A	5: 138,261,622	T391S	probably damaging	Het
Ccdc70	G	A	8: 21,973,250	V19M	possibly damaging	Het
Ccp110	G	T	7: 118,730,012	E73*	probably null	Het
Cfap57	A	C	4: 118,595,848	S553A	probably benign	Het
Cftr	A	G	6: 18,221,614	K212E	probably benign	Het
Chkb	A	T	15: 89,428,165	Y216N	probably damaging	Het
Cntnap2	G	T	6: 45,920,834	D149Y	probably damaging	Het
Cpd	A	G	11: 76,846,222		probably null	Het
Creb3l1	C	T	2: 91,983,226	D489N	probably benign	Het
Crhbp	A	G	13: 95,442,245	F123L	probably damaging	Het
Cryab	T	C	9: 50,754,609	V100A	possibly damaging	Het
Csmd2	T	C	4: 128,521,930	I2684T	probably benign	Het
Ctbp2	G	T	7: 133,014,649	P186T	possibly damaging	Het
Ctnna2	T	C	6: 76,915,762	N814S	possibly damaging	Het
Dntt	T	C	19: 41,039,856	V197A	probably damaging	Het
Fam135a	G	A	1: 24,020,677	A1187V	possibly damaging	Het
Filip1l	A	T	16: 57,570,415	Q455H	probably benign	Het
Grm2	T	C	9: 106,653,990	E100G	probably damaging	Het
Gtf2ird2	G	A	5: 134,217,464	V855M	probably damaging	Het
Heatr9	A	T	11: 83,518,792	I118N	possibly damaging	Het
Htra3	T	C	5: 35,671,125	H137R	probably benign	Het
Iars	A	G	13: 49,709,661	S530G	probably damaging	Het
Klhdc4	T	A	8: 121,796,603	M510L	probably benign	Het
Lipc	T	C	9: 70,816,731	T204A	probably benign	Het
Lrp1	A	G	10: 127,553,779	V3129A	probably damaging	Het
Macf1	G	A	4: 123,494,909	T1120I	probably benign	Het
Map4	T	C	9: 110,038,377		probably benign	Het
Mbtps1	A	T	8: 119,533,348	V420D	probably damaging	Het
Mta2	G	T	19: 8,950,383	D523Y	probably benign	Het
Muc4	A	G	16: 32,756,296		probably benign	Het
Mug1	C	T	6: 121,878,943	Q965*	probably null	Het
Myo1e	T	A	9: 70,353,312	I584N	probably damaging	Het
Nolc1	T	C	19: 46,078,920	V80A	probably damaging	Het
Nop56	G	T	2: 130,275,725	V91L	probably benign	Het
Olfr1451	A	T	19: 12,999,219	M78L	probably benign	Het
Olfr191	A	T	16: 59,086,402	L27Q	probably damaging	Het
Olfr523	T	C	7: 140,177,020	V300A	probably damaging	Het
Osbpl3	T	C	6: 50,336,297	E107G	probably damaging	Het
Pde3a	T	A	6: 141,250,025	C146S	probably benign	Het
Pfkm	A	G	15: 98,128,242	M573V	probably damaging	Het
Plekhg3	T	C	12: 76,565,247	I374T	possibly damaging	Het
Ppig	T	A	2: 69,741,486	V183D	unknown	Het
Prom1	T	G	5: 44,037,534	I290L	probably benign	Het
Rufy3	T	A	5: 88,637,226	M387K	probably damaging	Het
Selenoo	G	A	15: 89,094,184	R270H	probably damaging	Het
Sema3d	T	A	5: 12,508,087		probably null	Het
Sema6c	C	T	3: 95,168,363	T175I	probably damaging	Het
Serpina3k	T	C	12: 104,341,046	I179T	probably damaging	Het
Sf3b3	T	C	8: 110,841,203	T207A	probably benign	Het
Slc22a26	C	A	19: 7,802,181	R90L	probably damaging	Het
Slitrk5	T	C	14: 111,680,216	V424A	probably damaging	Het
Smarca2	G	T	19: 26,720,855	E89*	probably null	Het
Soga1	C	T	2: 157,022,856	G1144D	probably benign	Het
Stab2	T	A	10: 86,937,909	S853C	probably damaging	Het
Stk17b	A	T	1: 53,761,147		probably null	Het
Taar5	T	A	10: 23,971,547	I281N	possibly damaging	Het
Tarsl2	A	T	7: 65,658,935	E284D	probably damaging	Het
Tbx15	C	A	3: 99,316,333	T279K	probably damaging	Het
Tfr2	G	A	5: 137,586,925	V740I	probably benign	Het
Tlr12	T	C	4: 128,617,680	E259G	probably benign	Het
Tmem145	A	G	7: 25,309,034	T302A	probably benign	Het
Tmem57	A	G	4: 134,828,133	I343T	probably benign	Het
Trpa1	G	T	1: 14,875,861	H1015Q	probably benign	Het
Tspan8	A	G	10: 115,817,629	Y10C	possibly damaging	Het
Ttll7	A	G	3: 146,894,469	N44S	probably damaging	Het
Uba7	T	C	9: 107,979,839		probably null	Het
Ube2j2	G	A	4: 155,946,384	M1I	probably null	Het
Ubr5	C	A	15: 38,009,668	A1022S	probably benign	Het
Usf1	T	G	1: 171,415,763	I36S	probably damaging	Het
Vmn1r181	A	T	7: 23,984,365	D85V	probably damaging	Het
Vmn1r3	A	T	4: 3,185,009	Y99*	probably null	Het
Vmn1r72	T	C	7: 11,670,373	I49M	possibly damaging	Het
Vmn2r99	A	G	17: 19,362,135	M1V	probably null	Het
Vsig10	T	A	5: 117,343,975	V410E	probably damaging	Het
Zc3h7b	A	G	15: 81,779,133	Y442C	probably damaging	Het
Zfyve26	G	T	12: 79,280,385	Y730*	probably null	Het

Other mutations in Pkd1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Pkd1l2	APN	8	117059520	nonsense	probably null
IGL01353:Pkd1l2	APN	8	117057443	missense	probably benign	0.24
IGL01362:Pkd1l2	APN	8	117021856	missense	probably damaging	1.00
IGL01486:Pkd1l2	APN	8	117059592	missense	probably benign
IGL01672:Pkd1l2	APN	8	117080732	missense	possibly damaging	0.94
IGL01696:Pkd1l2	APN	8	117056387	missense	probably benign	0.12
IGL01819:Pkd1l2	APN	8	116998174	missense	probably damaging	1.00
IGL01833:Pkd1l2	APN	8	117060525	missense	probably benign	0.00
IGL01981:Pkd1l2	APN	8	117016916	missense	probably benign	0.04
IGL02066:Pkd1l2	APN	8	117009564	splice site	probably benign
IGL02381:Pkd1l2	APN	8	117035800	splice site	probably benign
IGL02416:Pkd1l2	APN	8	117040835	missense	possibly damaging	0.82
IGL02736:Pkd1l2	APN	8	117040666	missense	probably benign	0.00
IGL02828:Pkd1l2	APN	8	117029559	missense	probably benign
IGL02861:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02862:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02883:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02884:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02894:Pkd1l2	APN	8	117013891	missense	probably damaging	0.97
IGL02900:Pkd1l2	APN	8	117024091	missense	probably benign	0.03
IGL02901:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02929:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02941:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02957:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL02969:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03028:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03059:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03065:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03066:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03083:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03084:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03124:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03162:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03165:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03335:Pkd1l2	APN	8	117065745	missense	probably benign	0.07
IGL03357:Pkd1l2	APN	8	116995809	missense	probably damaging	1.00
IGL02835:Pkd1l2	UTSW	8	117065745	missense	probably benign	0.07
PIT4453001:Pkd1l2	UTSW	8	117022022	missense	probably benign	0.00
R0127:Pkd1l2	UTSW	8	117050048	splice site	probably benign
R0309:Pkd1l2	UTSW	8	116997576	missense	probably damaging	0.99
R0365:Pkd1l2	UTSW	8	117021850	missense	probably benign	0.02
R0526:Pkd1l2	UTSW	8	117082260	missense	probably damaging	1.00
R0571:Pkd1l2	UTSW	8	117082218	missense	probably benign	0.01
R0716:Pkd1l2	UTSW	8	117051100	missense	probably damaging	1.00
R0787:Pkd1l2	UTSW	8	117076177	missense	possibly damaging	0.90
R0893:Pkd1l2	UTSW	8	117044492	missense	probably damaging	0.99
R1256:Pkd1l2	UTSW	8	117019543	critical splice acceptor site	probably null
R1391:Pkd1l2	UTSW	8	117054934	missense	possibly damaging	0.87
R1474:Pkd1l2	UTSW	8	117065497	splice site	probably benign
R1491:Pkd1l2	UTSW	8	117028408	missense	probably damaging	1.00
R1520:Pkd1l2	UTSW	8	117046159	missense	probably benign	0.00
R1521:Pkd1l2	UTSW	8	117065500	splice site	probably null
R1544:Pkd1l2	UTSW	8	117038235	frame shift	probably null
R1558:Pkd1l2	UTSW	8	117082252	missense	possibly damaging	0.94
R1673:Pkd1l2	UTSW	8	117040775	missense	probably benign	0.00
R1691:Pkd1l2	UTSW	8	117056419	missense	possibly damaging	0.60
R1754:Pkd1l2	UTSW	8	117030719	missense	possibly damaging	0.81
R1857:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R1939:Pkd1l2	UTSW	8	117046182	nonsense	probably null
R1955:Pkd1l2	UTSW	8	117043361	missense	probably benign
R1957:Pkd1l2	UTSW	8	117030682	missense	probably damaging	1.00
R1959:Pkd1l2	UTSW	8	117043231	critical splice donor site	probably null
R2024:Pkd1l2	UTSW	8	117019533	missense	probably benign
R2046:Pkd1l2	UTSW	8	116999955	missense	probably damaging	1.00
R2102:Pkd1l2	UTSW	8	117081469	missense	probably damaging	0.98
R2116:Pkd1l2	UTSW	8	117030722	missense	possibly damaging	0.93
R2148:Pkd1l2	UTSW	8	117056325	missense	probably damaging	0.98
R2251:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2252:Pkd1l2	UTSW	8	117057438	missense	probably damaging	1.00
R2366:Pkd1l2	UTSW	8	117043317	missense	probably benign	0.01
R2566:Pkd1l2	UTSW	8	117019494	missense	probably damaging	1.00
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2872:Pkd1l2	UTSW	8	117038164	missense	probably benign	0.10
R2985:Pkd1l2	UTSW	8	117065551	missense	probably benign	0.00
R3055:Pkd1l2	UTSW	8	117068315	critical splice acceptor site	probably null
R3436:Pkd1l2	UTSW	8	117040739	missense	probably benign	0.01
R4732:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4733:Pkd1l2	UTSW	8	116995842	critical splice acceptor site	probably null
R4763:Pkd1l2	UTSW	8	117019429	missense	probably damaging	0.96
R4789:Pkd1l2	UTSW	8	117011575	missense	probably damaging	0.99
R4921:Pkd1l2	UTSW	8	117054885	missense	probably benign	0.03
R4921:Pkd1l2	UTSW	8	117072549	missense	probably damaging	0.97
R5057:Pkd1l2	UTSW	8	117055008	missense	probably benign	0.21
R5209:Pkd1l2	UTSW	8	117056442	missense	probably benign	0.23
R5241:Pkd1l2	UTSW	8	117035118	missense	probably damaging	1.00
R5480:Pkd1l2	UTSW	8	117030649	missense	probably damaging	0.99
R5501:Pkd1l2	UTSW	8	117065830	missense	probably damaging	0.98
R5533:Pkd1l2	UTSW	8	117068116	missense	probably benign	0.03
R5582:Pkd1l2	UTSW	8	117040783	nonsense	probably null
R5610:Pkd1l2	UTSW	8	117042320	missense	probably benign	0.04
R5770:Pkd1l2	UTSW	8	117055018	missense	probably damaging	1.00
R5854:Pkd1l2	UTSW	8	117065746	missense	possibly damaging	0.48
R5867:Pkd1l2	UTSW	8	117055011	missense	probably damaging	0.96
R5881:Pkd1l2	UTSW	8	116997582	missense	probably damaging	0.99
R5906:Pkd1l2	UTSW	8	117029648	missense	probably damaging	1.00
R5909:Pkd1l2	UTSW	8	117024056	missense	probably benign	0.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6030:Pkd1l2	UTSW	8	117043237	missense	probably damaging	1.00
R6084:Pkd1l2	UTSW	8	117013987	missense	probably damaging	1.00
R6122:Pkd1l2	UTSW	8	117082368	missense	probably benign	0.02
R6216:Pkd1l2	UTSW	8	117081470	missense	probably damaging	1.00
R6406:Pkd1l2	UTSW	8	117035847	missense	probably damaging	0.99
R6417:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6420:Pkd1l2	UTSW	8	117013899	missense	probably damaging	1.00
R6601:Pkd1l2	UTSW	8	117040666	missense	probably benign	0.00
R6743:Pkd1l2	UTSW	8	117030631	missense	probably damaging	1.00
R7053:Pkd1l2	UTSW	8	117013942	missense	probably damaging	1.00
R7144:Pkd1l2	UTSW	8	117076131	nonsense	probably null
R7148:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7169:Pkd1l2	UTSW	8	117040835	missense	possibly damaging	0.82
R7217:Pkd1l2	UTSW	8	116995797	missense	probably benign	0.24
R7310:Pkd1l2	UTSW	8	117024034	missense	probably benign
R7382:Pkd1l2	UTSW	8	117054871	missense	possibly damaging	0.95
R7397:Pkd1l2	UTSW	8	117035902	missense	possibly damaging	0.94
R7408:Pkd1l2	UTSW	8	117028479	missense	possibly damaging	0.77
R7437:Pkd1l2	UTSW	8	117030682	missense	probably damaging	0.96
R7492:Pkd1l2	UTSW	8	117068110	missense	probably damaging	1.00
R7496:Pkd1l2	UTSW	8	117060594	missense	possibly damaging	0.89
R7519:Pkd1l2	UTSW	8	117065529	missense	probably benign
R7590:Pkd1l2	UTSW	8	117080786	missense	probably benign	0.00
R7623:Pkd1l2	UTSW	8	117029645	missense	probably damaging	1.00
R7768:Pkd1l2	UTSW	8	117054860	critical splice donor site	probably null
R7897:Pkd1l2	UTSW	8	116998088	missense	possibly damaging	0.69
R7982:Pkd1l2	UTSW	8	117051187	missense	possibly damaging	0.70
R8024:Pkd1l2	UTSW	8	117076182	missense	possibly damaging	0.85
R8140:Pkd1l2	UTSW	8	117047497	missense	probably benign
R8145:Pkd1l2	UTSW	8	117055003	missense	probably benign
R8228:Pkd1l2	UTSW	8	117065775	missense	probably damaging	0.97
R8252:Pkd1l2	UTSW	8	117040733	missense	probably benign	0.29
R8500:Pkd1l2	UTSW	8	117047563	critical splice acceptor site	probably null
R8732:Pkd1l2	UTSW	8	117065572	missense	probably benign	0.28
R8809:Pkd1l2	UTSW	8	116999921	missense	probably damaging	1.00
R8896:Pkd1l2	UTSW	8	117013876	missense	possibly damaging	0.91
R8961:Pkd1l2	UTSW	8	116999978	missense	possibly damaging	0.52
R8985:Pkd1l2	UTSW	8	117038110	missense	probably benign	0.01
R9008:Pkd1l2	UTSW	8	117042298	missense	probably benign	0.32
R9091:Pkd1l2	UTSW	8	117032694	missense	probably damaging	1.00
R9138:Pkd1l2	UTSW	8	117055009	missense	probably benign	0.43
R9160:Pkd1l2	UTSW	8	117040669	missense	possibly damaging	0.70
R9249:Pkd1l2	UTSW	8	117019420	missense	probably damaging	0.99
R9270:Pkd1l2	UTSW	8	117032694	missense	probably damaging	1.00
R9735:Pkd1l2	UTSW	8	117046081	missense	possibly damaging	0.94
Z1176:Pkd1l2	UTSW	8	117054914	missense	probably damaging	1.00
Z1177:Pkd1l2	UTSW	8	117030691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGATTCACTAAGTGCAGGG -3'
(R):5'- TGATCACAGTGGGAAGCCAG -3'

Sequencing Primer
(F):5'- CAGGGACCCTGTTCTGTGTG -3'
(R):5'- AAGCCAGCTGTGCTCTG -3'

Posted On

2017-01-23