Incidental Mutation 'R0553:Hey2'
ID 45289
Institutional Source Beutler Lab
Gene Symbol Hey2
Ensembl Gene ENSMUSG00000019789
Gene Name hairy/enhancer-of-split related with YRPW motif 2
Synonyms bHLHb32, Hesr2, CHF1, Herp1, Hrt2
MMRRC Submission 038745-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock # R0553 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 30832359-30842801 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 30840489 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000019924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019924]
AlphaFold Q9QUS4
Predicted Effect probably benign
Transcript: ENSMUST00000019924
SMART Domains Protein: ENSMUSP00000019924
Gene: ENSMUSG00000019789

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
HLH 54 109 6.71e-16 SMART
ORANGE 119 166 5.55e-18 SMART
low complexity region 174 193 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217504
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac hypertrophy, ventricular septal defects, pulmonary and liver congestion, and reduced preweaning viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,686 I729V probably damaging Het
9530002B09Rik A T 4: 122,702,335 M120L unknown Het
Adamts13 T A 2: 26,991,334 C774* probably null Het
Amh A G 10: 80,806,176 probably benign Het
Ccdc173 C A 2: 69,789,441 R8L probably damaging Het
Cd40 G A 2: 165,070,741 R204Q probably benign Het
Clhc1 A C 11: 29,561,366 probably benign Het
Fbxl17 G A 17: 63,356,851 R67C probably damaging Het
Flg2 A T 3: 93,203,584 H973L unknown Het
Fut2 T A 7: 45,651,274 I25F probably damaging Het
Galnt7 T C 8: 57,552,430 probably benign Het
Gm438 T A 4: 144,777,415 I389L possibly damaging Het
Gm7534 T C 4: 134,202,518 T159A possibly damaging Het
Gm8909 G T 17: 36,168,057 P100Q probably damaging Het
Gmppb A T 9: 108,049,797 M56L probably benign Het
Grm3 C A 5: 9,570,048 A399S probably benign Het
Ift172 A G 5: 31,275,842 probably benign Het
Kcnh5 C A 12: 75,137,673 C92F probably benign Het
Kdm1a T C 4: 136,555,298 D229G probably damaging Het
Klf11 C G 12: 24,655,090 P164R probably benign Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Krtcap3 T C 5: 31,251,803 V6A probably benign Het
Ltbr A C 6: 125,313,388 probably null Het
Mmp17 T G 5: 129,598,670 S298A probably benign Het
Nacc2 T A 2: 26,089,590 E278V possibly damaging Het
Olfr175-ps1 A T 16: 58,824,155 Y185N probably damaging Het
Olfr875 T A 9: 37,773,331 I224N probably benign Het
Otop2 C T 11: 115,329,462 A376V probably damaging Het
Pdia2 T C 17: 26,196,243 E504G probably damaging Het
Pdzph1 C T 17: 58,922,727 V979M probably damaging Het
Pou5f1 A G 17: 35,509,477 K86R possibly damaging Het
Ptprq A G 10: 107,710,627 F269L probably benign Het
Rb1 A T 14: 73,211,712 C659* probably null Het
Rnf8 T C 17: 29,621,639 probably null Het
Rras T G 7: 45,020,556 I137M probably benign Het
Slc38a9 A T 13: 112,714,198 H372L probably damaging Het
Spata9 T C 13: 75,977,779 probably null Het
Tas2r115 T C 6: 132,737,959 T10A probably benign Het
Ttn T C 2: 76,798,893 E12621G probably damaging Het
Unc80 A T 1: 66,506,669 I460F probably damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zbtb24 C T 10: 41,451,997 A293V possibly damaging Het
Other mutations in Hey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Hey2 APN 10 30834137 missense probably benign 0.25
IGL02525:Hey2 APN 10 30842647 start codon destroyed probably null 0.99
R0167:Hey2 UTSW 10 30840665 missense probably benign 0.04
R0279:Hey2 UTSW 10 30834010 missense probably damaging 0.97
R0592:Hey2 UTSW 10 30833957 missense probably benign 0.44
R0621:Hey2 UTSW 10 30834386 missense probably benign 0.36
R1437:Hey2 UTSW 10 30833849 missense probably benign 0.00
R1457:Hey2 UTSW 10 30834356 missense probably benign 0.45
R2449:Hey2 UTSW 10 30840446 missense possibly damaging 0.94
R4721:Hey2 UTSW 10 30834308 missense possibly damaging 0.65
R4755:Hey2 UTSW 10 30834304 missense probably benign 0.00
R4828:Hey2 UTSW 10 30834183 missense possibly damaging 0.95
R5419:Hey2 UTSW 10 30834023 missense probably benign
R6927:Hey2 UTSW 10 30834417 missense probably benign 0.16
R7079:Hey2 UTSW 10 30834386 missense probably benign 0.36
R8196:Hey2 UTSW 10 30834277 missense probably benign
R8238:Hey2 UTSW 10 30840663 missense probably benign
R8381:Hey2 UTSW 10 30833990 missense probably damaging 1.00
R8383:Hey2 UTSW 10 30840669 missense probably benign 0.01
R8730:Hey2 UTSW 10 30842626 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCACAGTTTTAAGCAAAACCCCTGC -3'
(R):5'- TGATGAGGTCCAATTCACCGACAAC -3'

Sequencing Primer
(F):5'- TTCTACGCCGGATCAGAGTG -3'
(R):5'- ACTACCTCTCAGATTATGGCAAG -3'
Posted On 2013-06-11